Incidental Mutation 'R7714:Atp6v0a2'
ID 594783
Institutional Source Beutler Lab
Gene Symbol Atp6v0a2
Ensembl Gene ENSMUSG00000038023
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms Tj6, ATP6a2, Atp6n2, 8430408C20Rik, V-ATPase a2, TJ6s
MMRRC Submission 045772-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.135) question?
Stock # R7714 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 124767117-124801519 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 124775533 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 135 (T135M)
Ref Sequence ENSEMBL: ENSMUSP00000039737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000198382]
AlphaFold P15920
PDB Structure NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000037865
AA Change: T135M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: T135M

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 842 3.3e-299 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000198382
AA Change: T135M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023
AA Change: T135M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:V_ATPase_I 26 178 1.5e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,167,587 (GRCm39) probably null Het
Agrn C A 4: 156,279,854 (GRCm39) D106Y probably damaging Het
Arfgap3 A T 15: 83,192,352 (GRCm39) Y416N probably benign Het
Bach1 C A 16: 87,515,736 (GRCm39) Y92* probably null Het
Catsperg1 A C 7: 28,884,907 (GRCm39) C905G probably null Het
Cbr2 T C 11: 120,620,628 (GRCm39) I219V probably benign Het
Ccdc3 A T 2: 5,233,908 (GRCm39) K244I probably damaging Het
Cd226 T C 18: 89,265,433 (GRCm39) V237A probably damaging Het
Chek2 T C 5: 110,989,319 (GRCm39) C81R probably benign Het
Col27a1 T C 4: 63,242,723 (GRCm39) probably null Het
Cracdl T A 1: 37,663,858 (GRCm39) Q680L probably benign Het
Crybg3 A T 16: 59,379,236 (GRCm39) S673T probably benign Het
Csmd2 T A 4: 128,276,743 (GRCm39) Y848* probably null Het
Dgkb C A 12: 38,680,592 (GRCm39) T764K probably damaging Het
Dock4 T A 12: 40,775,648 (GRCm39) C530* probably null Het
Dpyd A G 3: 118,597,780 (GRCm39) K254R probably benign Het
Dstyk C T 1: 132,384,614 (GRCm39) P703S possibly damaging Het
Ehhadh A T 16: 21,585,140 (GRCm39) I247N probably damaging Het
Fer1l5 T G 1: 36,440,558 (GRCm39) L597R probably damaging Het
Fignl1 T C 11: 11,752,842 (GRCm39) E71G probably damaging Het
Fnip2 A C 3: 79,425,421 (GRCm39) V58G probably damaging Het
Gapdhs A T 7: 30,431,349 (GRCm39) I377N probably damaging Het
Gcn1 C T 5: 115,733,359 (GRCm39) A1059V probably damaging Het
Gpd1 G A 15: 99,619,967 (GRCm39) S255N probably damaging Het
Grik2 A C 10: 49,295,792 (GRCm39) I392S probably damaging Het
Hoxb3 T C 11: 96,236,606 (GRCm39) L228P probably damaging Het
Iws1 A T 18: 32,223,568 (GRCm39) M659L probably benign Het
Kmt2c A G 5: 25,580,364 (GRCm39) C570R probably benign Het
Lamc3 T A 2: 31,812,279 (GRCm39) probably null Het
Lipf G A 19: 33,943,048 (GRCm39) G119R probably damaging Het
Lrrc37 T C 11: 103,507,719 (GRCm39) I1416M unknown Het
Magel2 A T 7: 62,028,130 (GRCm39) I345L probably benign Het
Mdn1 G A 4: 32,722,360 (GRCm39) A2381T possibly damaging Het
Med12l T C 3: 59,001,007 (GRCm39) V690A probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,427,071 (GRCm39) probably benign Het
Mob3b A G 4: 35,083,872 (GRCm39) Y106H probably damaging Het
Myo1c T C 11: 75,549,519 (GRCm39) Y166H probably damaging Het
Ndst4 A T 3: 125,364,493 (GRCm39) H390L probably benign Het
Nt5c1b T A 12: 10,425,472 (GRCm39) N280K probably damaging Het
Or10aa1 G A 1: 173,869,900 (GRCm39) R128H probably benign Het
Or5b116 A T 19: 13,423,252 (GRCm39) N292I probably damaging Het
Otof A G 5: 30,527,597 (GRCm39) F1947L probably damaging Het
Pabpc4 G A 4: 123,189,102 (GRCm39) A481T probably benign Het
Parm1 C T 5: 91,741,791 (GRCm39) T53I possibly damaging Het
Pilra C T 5: 137,833,679 (GRCm39) R129Q probably benign Het
Pkd1 C T 17: 24,769,250 (GRCm39) A5V unknown Het
Pmch T C 10: 87,927,242 (GRCm39) S82P probably benign Het
Prf1 G A 10: 61,135,934 (GRCm39) R70H possibly damaging Het
Rad51c T C 11: 87,292,276 (GRCm39) S180G probably benign Het
Rassf8 A C 6: 145,760,973 (GRCm39) T100P probably damaging Het
Rnpepl1 A G 1: 92,844,890 (GRCm39) E394G probably damaging Het
Rufy2 T A 10: 62,838,772 (GRCm39) V418E probably benign Het
Sdad1 A T 5: 92,450,538 (GRCm39) V199D probably damaging Het
Sptbn4 A T 7: 27,063,761 (GRCm39) S2227T probably benign Het
Tac4 A G 11: 95,156,116 (GRCm39) M66V probably benign Het
Tas2r126 T C 6: 42,412,031 (GRCm39) V188A probably benign Het
Tcerg1 T C 18: 42,694,000 (GRCm39) V707A possibly damaging Het
Tmem273 A G 14: 32,527,129 (GRCm39) E32G possibly damaging Het
Trav13d-4 G A 14: 53,995,355 (GRCm39) G103D probably damaging Het
Trav8d-1 A G 14: 53,016,380 (GRCm39) S89G probably benign Het
Ttll4 C T 1: 74,718,572 (GRCm39) S141L probably benign Het
Vash1 T C 12: 86,738,614 (GRCm39) S354P probably benign Het
Vmn2r40 T A 7: 8,911,116 (GRCm39) I726F Het
Vmn2r53 A C 7: 12,340,418 (GRCm39) N18K probably damaging Het
Wnt6 T C 1: 74,823,422 (GRCm39) F253S probably damaging Het
Zfp599 A G 9: 22,161,811 (GRCm39) I118T probably benign Het
Other mutations in Atp6v0a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp6v0a2 APN 5 124,798,841 (GRCm39) missense probably benign 0.19
IGL01310:Atp6v0a2 APN 5 124,783,968 (GRCm39) missense probably damaging 1.00
IGL01944:Atp6v0a2 APN 5 124,774,043 (GRCm39) missense probably benign 0.04
IGL02044:Atp6v0a2 APN 5 124,783,954 (GRCm39) missense probably benign 0.00
IGL02400:Atp6v0a2 APN 5 124,798,849 (GRCm39) missense probably benign
IGL02650:Atp6v0a2 APN 5 124,789,426 (GRCm39) splice site probably benign
IGL02687:Atp6v0a2 APN 5 124,791,206 (GRCm39) missense possibly damaging 0.67
IGL02965:Atp6v0a2 APN 5 124,767,267 (GRCm39) missense possibly damaging 0.85
IGL03049:Atp6v0a2 APN 5 124,789,845 (GRCm39) missense probably damaging 1.00
IGL03088:Atp6v0a2 APN 5 124,791,171 (GRCm39) splice site probably benign
IGL03198:Atp6v0a2 APN 5 124,789,425 (GRCm39) critical splice donor site probably null
alkaline UTSW 5 124,796,930 (GRCm39) missense probably damaging 1.00
basic UTSW 5 124,789,392 (GRCm39) nonsense probably null
electronegative UTSW 5 124,784,638 (GRCm39) missense probably damaging 1.00
energizer UTSW 5 124,797,050 (GRCm39) missense probably damaging 0.98
Everready UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
Lithium UTSW 5 124,791,209 (GRCm39) missense probably damaging 1.00
R0128:Atp6v0a2 UTSW 5 124,790,248 (GRCm39) missense probably damaging 1.00
R0594:Atp6v0a2 UTSW 5 124,795,046 (GRCm39) missense probably benign 0.01
R1540:Atp6v0a2 UTSW 5 124,784,638 (GRCm39) missense probably damaging 1.00
R2136:Atp6v0a2 UTSW 5 124,795,552 (GRCm39) missense possibly damaging 0.78
R2921:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R2922:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R2923:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R3055:Atp6v0a2 UTSW 5 124,765,209 (GRCm39) unclassified probably benign
R3889:Atp6v0a2 UTSW 5 124,777,203 (GRCm39) missense probably damaging 1.00
R3893:Atp6v0a2 UTSW 5 124,777,203 (GRCm39) missense probably damaging 1.00
R4013:Atp6v0a2 UTSW 5 124,789,860 (GRCm39) missense probably damaging 1.00
R4490:Atp6v0a2 UTSW 5 124,784,674 (GRCm39) missense probably damaging 1.00
R4791:Atp6v0a2 UTSW 5 124,784,667 (GRCm39) missense probably benign 0.17
R5219:Atp6v0a2 UTSW 5 124,790,249 (GRCm39) missense probably damaging 1.00
R5247:Atp6v0a2 UTSW 5 124,790,241 (GRCm39) missense probably damaging 1.00
R5293:Atp6v0a2 UTSW 5 124,784,649 (GRCm39) missense probably benign 0.00
R5620:Atp6v0a2 UTSW 5 124,783,909 (GRCm39) nonsense probably null
R5830:Atp6v0a2 UTSW 5 124,779,485 (GRCm39) missense probably damaging 1.00
R5875:Atp6v0a2 UTSW 5 124,793,391 (GRCm39) missense probably benign
R5903:Atp6v0a2 UTSW 5 124,789,343 (GRCm39) missense probably damaging 1.00
R6192:Atp6v0a2 UTSW 5 124,767,268 (GRCm39) missense probably benign 0.01
R6425:Atp6v0a2 UTSW 5 124,790,194 (GRCm39) missense probably damaging 1.00
R6752:Atp6v0a2 UTSW 5 124,779,452 (GRCm39) missense probably damaging 1.00
R6919:Atp6v0a2 UTSW 5 124,789,225 (GRCm39) splice site probably null
R6994:Atp6v0a2 UTSW 5 124,791,209 (GRCm39) missense probably damaging 1.00
R7053:Atp6v0a2 UTSW 5 124,783,923 (GRCm39) missense probably damaging 1.00
R7268:Atp6v0a2 UTSW 5 124,796,930 (GRCm39) missense probably damaging 1.00
R7342:Atp6v0a2 UTSW 5 124,784,676 (GRCm39) missense probably damaging 1.00
R7349:Atp6v0a2 UTSW 5 124,789,392 (GRCm39) nonsense probably null
R7715:Atp6v0a2 UTSW 5 124,791,262 (GRCm39) missense probably damaging 0.99
R7748:Atp6v0a2 UTSW 5 124,793,560 (GRCm39) missense probably benign 0.00
R7775:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7778:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7824:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7833:Atp6v0a2 UTSW 5 124,782,969 (GRCm39) missense probably damaging 1.00
R7901:Atp6v0a2 UTSW 5 124,779,485 (GRCm39) missense probably damaging 1.00
R7977:Atp6v0a2 UTSW 5 124,797,050 (GRCm39) missense probably damaging 0.98
R7987:Atp6v0a2 UTSW 5 124,797,050 (GRCm39) missense probably damaging 0.98
R8118:Atp6v0a2 UTSW 5 124,789,837 (GRCm39) missense probably damaging 0.98
R8728:Atp6v0a2 UTSW 5 124,796,152 (GRCm39) missense probably benign 0.00
R8765:Atp6v0a2 UTSW 5 124,793,534 (GRCm39) missense probably damaging 1.00
R8945:Atp6v0a2 UTSW 5 124,784,589 (GRCm39) missense probably damaging 1.00
R8971:Atp6v0a2 UTSW 5 124,797,061 (GRCm39) missense probably damaging 1.00
R9023:Atp6v0a2 UTSW 5 124,796,138 (GRCm39) missense possibly damaging 0.93
R9300:Atp6v0a2 UTSW 5 124,789,312 (GRCm39) missense probably damaging 0.98
R9360:Atp6v0a2 UTSW 5 124,767,259 (GRCm39) missense possibly damaging 0.77
R9601:Atp6v0a2 UTSW 5 124,790,257 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTTGCATTCTGGCTTGCTG -3'
(R):5'- GAGATAGCTCAGTTGACAGGGC -3'

Sequencing Primer
(F):5'- TTGCTGCCAGGCACAGTG -3'
(R):5'- GCCAGCTTTAACTCCAGGACTG -3'
Posted On 2019-11-12