Incidental Mutation 'R7714:Tas2r126'
ID594785
Institutional Source Beutler Lab
Gene Symbol Tas2r126
Ensembl Gene ENSMUSG00000048284
Gene Nametaste receptor, type 2, member 126
SynonymsT2R12, mt2r35, T2R26, mGR26, Tas2r26
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7714 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42434535-42435464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42435097 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 188 (V188A)
Ref Sequence ENSEMBL: ENSMUSP00000056581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059534]
Predicted Effect probably benign
Transcript: ENSMUST00000059534
AA Change: V188A

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000056581
Gene: ENSMUSG00000048284
AA Change: V188A

DomainStartEndE-ValueType
Pfam:TAS2R 1 303 2.5e-97 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810011H11Rik A G 14: 32,805,172 E32G possibly damaging Het
2010300C02Rik T A 1: 37,624,777 Q680L probably benign Het
Adam22 A G 5: 8,117,587 probably null Het
Agrn C A 4: 156,195,397 D106Y probably damaging Het
Arfgap3 A T 15: 83,308,151 Y416N probably benign Het
Atp6v0a2 C T 5: 124,637,595 T135M probably damaging Het
Bach1 C A 16: 87,718,848 Y92* probably null Het
Catsperg1 A C 7: 29,185,482 C905G probably null Het
Cbr2 T C 11: 120,729,802 I219V probably benign Het
Ccdc3 A T 2: 5,229,097 K244I probably damaging Het
Cd226 T C 18: 89,247,309 V237A probably damaging Het
Chek2 T C 5: 110,841,453 C81R probably benign Het
Col27a1 T C 4: 63,324,486 probably null Het
Crybg3 A T 16: 59,558,873 S673T probably benign Het
Csmd2 T A 4: 128,382,950 Y848* probably null Het
Dgkb C A 12: 38,630,593 T764K probably damaging Het
Dock4 T A 12: 40,725,649 C530* probably null Het
Dpyd A G 3: 118,804,131 K254R probably benign Het
Dstyk C T 1: 132,456,876 P703S possibly damaging Het
Ehhadh A T 16: 21,766,390 I247N probably damaging Het
Fer1l5 T G 1: 36,401,477 L597R probably damaging Het
Fignl1 T C 11: 11,802,842 E71G probably damaging Het
Fnip2 A C 3: 79,518,114 V58G probably damaging Het
Gapdhs A T 7: 30,731,924 I377N probably damaging Het
Gcn1l1 C T 5: 115,595,300 A1059V probably damaging Het
Gm884 T C 11: 103,616,893 I1416M unknown Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Grik2 A C 10: 49,419,696 I392S probably damaging Het
Hoxb3 T C 11: 96,345,780 L228P probably damaging Het
Iws1 A T 18: 32,090,515 M659L probably benign Het
Kmt2c A G 5: 25,375,366 C570R probably benign Het
Lamc3 T A 2: 31,922,267 probably null Het
Lipf G A 19: 33,965,648 G119R probably damaging Het
Magel2 A T 7: 62,378,382 I345L probably benign Het
Mdn1 G A 4: 32,722,360 A2381T possibly damaging Het
Med12l T C 3: 59,093,586 V690A probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Mob3b A G 4: 35,083,872 Y106H probably damaging Het
Myo1c T C 11: 75,658,693 Y166H probably damaging Het
Ndst4 A T 3: 125,570,844 H390L probably benign Het
Nt5c1b T A 12: 10,375,472 N280K probably damaging Het
Olfr1471 A T 19: 13,445,888 N292I probably damaging Het
Olfr433 G A 1: 174,042,334 R128H probably benign Het
Otof A G 5: 30,370,253 F1947L probably damaging Het
Pabpc4 G A 4: 123,295,309 A481T probably benign Het
Parm1 C T 5: 91,593,932 T53I possibly damaging Het
Pilra C T 5: 137,835,417 R129Q probably benign Het
Pkd1 C T 17: 24,550,276 A5V unknown Het
Pmch T C 10: 88,091,380 S82P probably benign Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Rad51c T C 11: 87,401,450 S180G probably benign Het
Rassf8 A C 6: 145,815,247 T100P probably damaging Het
Rnpepl1 A G 1: 92,917,168 E394G probably damaging Het
Rufy2 T A 10: 63,002,993 V418E probably benign Het
Sdad1 A T 5: 92,302,679 V199D probably damaging Het
Sptbn4 A T 7: 27,364,336 S2227T probably benign Het
Tac4 A G 11: 95,265,290 M66V probably benign Het
Tcerg1 T C 18: 42,560,935 V707A possibly damaging Het
Trav13-4-dv7 G A 14: 53,757,898 G103D probably damaging Het
Trav8d-1 A G 14: 52,778,923 S89G probably benign Het
Ttll4 C T 1: 74,679,413 S141L probably benign Het
Vash1 T C 12: 86,691,840 S354P probably benign Het
Vmn2r40 T A 7: 8,908,117 I726F Het
Vmn2r53 A C 7: 12,606,491 N18K probably damaging Het
Wnt6 T C 1: 74,784,263 F253S probably damaging Het
Zfp599 A G 9: 22,250,515 I118T probably benign Het
Other mutations in Tas2r126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Tas2r126 APN 6 42435349 missense possibly damaging 0.67
IGL01327:Tas2r126 APN 6 42434750 missense probably benign 0.09
IGL01690:Tas2r126 APN 6 42435307 missense probably benign 0.02
IGL02153:Tas2r126 APN 6 42434664 missense probably benign 0.32
IGL02291:Tas2r126 APN 6 42435287 missense probably benign 0.00
IGL03365:Tas2r126 APN 6 42435457 missense probably benign 0.36
R0091:Tas2r126 UTSW 6 42435102 missense probably benign
R0486:Tas2r126 UTSW 6 42435291 missense probably benign 0.01
R0611:Tas2r126 UTSW 6 42435091 missense probably damaging 0.99
R1527:Tas2r126 UTSW 6 42435136 missense probably benign 0.03
R1529:Tas2r126 UTSW 6 42434568 missense probably benign 0.00
R1883:Tas2r126 UTSW 6 42435027 missense probably benign
R1884:Tas2r126 UTSW 6 42435027 missense probably benign
R2039:Tas2r126 UTSW 6 42434623 missense probably benign 0.22
R4863:Tas2r126 UTSW 6 42435390 missense probably benign 0.02
R5975:Tas2r126 UTSW 6 42435000 missense possibly damaging 0.69
R7127:Tas2r126 UTSW 6 42434805 missense probably damaging 1.00
R7351:Tas2r126 UTSW 6 42435306 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTGGAGATTCCCAGCGTTG -3'
(R):5'- ACTGTAGCATCAATGATCATGGAC -3'

Sequencing Primer
(F):5'- ATTCCCAGCGTTGGTGCC -3'
(R):5'- TAGCATCAATGATCATGGACACAAAG -3'
Posted On2019-11-12