Mutagenetix > Incidental Mutations

Incidental Mutation 'R7714:Rassf8'

594786

Institutional Source

Beutler Lab

Gene Symbol

Rassf8

Ensembl Gene

ENSMUSG00000030259

Gene Name

Ras association (RalGDS/AF-6) domain family (N-terminal) member 8

Synonyms

5133400D11Rik, mHoj-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.774) question?

Stock #

R7714 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

145746748-145821079 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 145815247 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 100 (T100P)

Ref Sequence

ENSEMBL: ENSMUSP00000032388 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032388] [ENSMUST00000058538] [ENSMUST00000111704] [ENSMUST00000140966]

Predicted Effect

probably damaging
Transcript: ENSMUST00000032388
AA Change: T100P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000032388
Gene: ENSMUSG00000030259
AA Change: T100P

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000058538

Predicted Effect

probably damaging
Transcript: ENSMUST00000111704
AA Change: T100P

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000107333
Gene: ENSMUSG00000030259
AA Change: T100P

Domain	Start	End	E-Value	Type
RA	1	82	4.17e-11	SMART
coiled coil region	161	354	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140966

SMART Domains

Protein: ENSMUSP00000122684
Gene: ENSMUSG00000030259

Domain	Start	End	E-Value	Type
RA	1	80	7.85e-7	SMART

Meta Mutation Damage Score

0.0609

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

97% (63/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810011H11Rik	A	G	14: 32,805,172	E32G	possibly damaging	Het
2010300C02Rik	T	A	1: 37,624,777	Q680L	probably benign	Het
Adam22	A	G	5: 8,117,587		probably null	Het
Agrn	C	A	4: 156,195,397	D106Y	probably damaging	Het
Arfgap3	A	T	15: 83,308,151	Y416N	probably benign	Het
Atp6v0a2	C	T	5: 124,637,595	T135M	probably damaging	Het
Bach1	C	A	16: 87,718,848	Y92*	probably null	Het
Catsperg1	A	C	7: 29,185,482	C905G	probably null	Het
Cbr2	T	C	11: 120,729,802	I219V	probably benign	Het
Ccdc3	A	T	2: 5,229,097	K244I	probably damaging	Het
Cd226	T	C	18: 89,247,309	V237A	probably damaging	Het
Chek2	T	C	5: 110,841,453	C81R	probably benign	Het
Col27a1	T	C	4: 63,324,486		probably null	Het
Crybg3	A	T	16: 59,558,873	S673T	probably benign	Het
Csmd2	T	A	4: 128,382,950	Y848*	probably null	Het
Dgkb	C	A	12: 38,630,593	T764K	probably damaging	Het
Dock4	T	A	12: 40,725,649	C530*	probably null	Het
Dpyd	A	G	3: 118,804,131	K254R	probably benign	Het
Dstyk	C	T	1: 132,456,876	P703S	possibly damaging	Het
Ehhadh	A	T	16: 21,766,390	I247N	probably damaging	Het
Fer1l5	T	G	1: 36,401,477	L597R	probably damaging	Het
Fignl1	T	C	11: 11,802,842	E71G	probably damaging	Het
Fnip2	A	C	3: 79,518,114	V58G	probably damaging	Het
Gapdhs	A	T	7: 30,731,924	I377N	probably damaging	Het
Gcn1l1	C	T	5: 115,595,300	A1059V	probably damaging	Het
Gm884	T	C	11: 103,616,893	I1416M	unknown	Het
Gpd1	G	A	15: 99,722,086	S255N	probably damaging	Het
Grik2	A	C	10: 49,419,696	I392S	probably damaging	Het
Hoxb3	T	C	11: 96,345,780	L228P	probably damaging	Het
Iws1	A	T	18: 32,090,515	M659L	probably benign	Het
Kmt2c	A	G	5: 25,375,366	C570R	probably benign	Het
Lamc3	T	A	2: 31,922,267		probably null	Het
Lipf	G	A	19: 33,965,648	G119R	probably damaging	Het
Magel2	A	T	7: 62,378,382	I345L	probably benign	Het
Mdn1	G	A	4: 32,722,360	A2381T	possibly damaging	Het
Med12l	T	C	3: 59,093,586	V690A	probably benign	Het
Megf10	GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA	GGCAGCAACAGCACCAGCAGCA	18: 57,293,999		probably benign	Het
Mob3b	A	G	4: 35,083,872	Y106H	probably damaging	Het
Myo1c	T	C	11: 75,658,693	Y166H	probably damaging	Het
Ndst4	A	T	3: 125,570,844	H390L	probably benign	Het
Nt5c1b	T	A	12: 10,375,472	N280K	probably damaging	Het
Olfr1471	A	T	19: 13,445,888	N292I	probably damaging	Het
Olfr433	G	A	1: 174,042,334	R128H	probably benign	Het
Otof	A	G	5: 30,370,253	F1947L	probably damaging	Het
Pabpc4	G	A	4: 123,295,309	A481T	probably benign	Het
Parm1	C	T	5: 91,593,932	T53I	possibly damaging	Het
Pilra	C	T	5: 137,835,417	R129Q	probably benign	Het
Pkd1	C	T	17: 24,550,276	A5V	unknown	Het
Pmch	T	C	10: 88,091,380	S82P	probably benign	Het
Prf1	G	A	10: 61,300,155	R70H	possibly damaging	Het
Rad51c	T	C	11: 87,401,450	S180G	probably benign	Het
Rnpepl1	A	G	1: 92,917,168	E394G	probably damaging	Het
Rufy2	T	A	10: 63,002,993	V418E	probably benign	Het
Sdad1	A	T	5: 92,302,679	V199D	probably damaging	Het
Sptbn4	A	T	7: 27,364,336	S2227T	probably benign	Het
Tac4	A	G	11: 95,265,290	M66V	probably benign	Het
Tas2r126	T	C	6: 42,435,097	V188A	probably benign	Het
Tcerg1	T	C	18: 42,560,935	V707A	possibly damaging	Het
Trav13-4-dv7	G	A	14: 53,757,898	G103D	probably damaging	Het
Trav8d-1	A	G	14: 52,778,923	S89G	probably benign	Het
Ttll4	C	T	1: 74,679,413	S141L	probably benign	Het
Vash1	T	C	12: 86,691,840	S354P	probably benign	Het
Vmn2r40	T	A	7: 8,908,117	I726F		Het
Vmn2r53	A	C	7: 12,606,491	N18K	probably damaging	Het
Wnt6	T	C	1: 74,784,263	F253S	probably damaging	Het
Zfp599	A	G	9: 22,250,515	I118T	probably benign	Het

Other mutations in Rassf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02973:Rassf8	APN	6	145817190	unclassified	probably benign
IGL03017:Rassf8	APN	6	145817198	splice site	probably null
IGL03091:Rassf8	APN	6	145815810	missense	probably benign	0.00
R0230:Rassf8	UTSW	6	145819974	unclassified	probably benign
R0967:Rassf8	UTSW	6	145819950	unclassified	probably benign
R1429:Rassf8	UTSW	6	145815190	missense	probably damaging	1.00
R1622:Rassf8	UTSW	6	145820103	unclassified	probably benign
R1738:Rassf8	UTSW	6	145815308	missense	probably benign	0.03
R1894:Rassf8	UTSW	6	145808473	missense	probably damaging	1.00
R2126:Rassf8	UTSW	6	145815182	missense	probably benign	0.00
R2238:Rassf8	UTSW	6	145817184	missense	probably damaging	1.00
R2439:Rassf8	UTSW	6	145815334	missense	probably damaging	1.00
R3699:Rassf8	UTSW	6	145820076	unclassified	probably benign
R4678:Rassf8	UTSW	6	145815082	missense	probably damaging	1.00
R4734:Rassf8	UTSW	6	145815540	missense	probably benign	0.34
R4826:Rassf8	UTSW	6	145816550	missense	probably damaging	1.00
R4910:Rassf8	UTSW	6	145815280	nonsense	probably null
R4988:Rassf8	UTSW	6	145817144	missense	possibly damaging	0.89
R5425:Rassf8	UTSW	6	145815542	missense	probably benign
R5620:Rassf8	UTSW	6	145820181	unclassified	probably benign
R5747:Rassf8	UTSW	6	145815815	missense	probably benign	0.00
R6136:Rassf8	UTSW	6	145815656	missense	probably benign	0.00
R6220:Rassf8	UTSW	6	145817133	missense	probably damaging	1.00
R7274:Rassf8	UTSW	6	145815569	missense	probably benign	0.03
R7315:Rassf8	UTSW	6	145815751	missense	probably benign
R7480:Rassf8	UTSW	6	145820031	missense	unknown
R7593:Rassf8	UTSW	6	145815403	missense	probably benign	0.08
R7962:Rassf8	UTSW	6	145815943	critical splice donor site	probably null
R8222:Rassf8	UTSW	6	145820057	missense	unknown
R8374:Rassf8	UTSW	6	145815137	nonsense	probably null
R8409:Rassf8	UTSW	6	145815703	missense	probably benign
Z1088:Rassf8	UTSW	6	145815482	missense	probably benign
Z1088:Rassf8	UTSW	6	145816616	missense	probably benign	0.41
Z1176:Rassf8	UTSW	6	145816642	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCGAACTGGAAGGTACACCC -3'
(R):5'- GGATCAGCCTTTTCAGCTCC -3'

Sequencing Primer
(F):5'- ACTGGAAGGTACACCCTGATAG -3'
(R):5'- GTTGCCCTGCAGTTACTCAG -3'

Posted On

2019-11-12