Incidental Mutation 'R7714:Vmn2r53'
ID 594788
Institutional Source Beutler Lab
Gene Symbol Vmn2r53
Ensembl Gene ENSMUSG00000096002
Gene Name vomeronasal 2, receptor 53
Synonyms EG637908
MMRRC Submission 045772-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R7714 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 12315397-12342583 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 12340418 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 18 (N18K)
Ref Sequence ENSEMBL: ENSMUSP00000126979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170412]
AlphaFold A0A3B2W4A7
Predicted Effect probably damaging
Transcript: ENSMUST00000170412
AA Change: N18K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126979
Gene: ENSMUSG00000096002
AA Change: N18K

DomainStartEndE-ValueType
Pfam:ANF_receptor 5 397 3.6e-58 PFAM
Pfam:NCD3G 442 495 2.2e-19 PFAM
Pfam:7tm_3 526 763 3.1e-53 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam22 A G 5: 8,167,587 (GRCm39) probably null Het
Agrn C A 4: 156,279,854 (GRCm39) D106Y probably damaging Het
Arfgap3 A T 15: 83,192,352 (GRCm39) Y416N probably benign Het
Atp6v0a2 C T 5: 124,775,533 (GRCm39) T135M probably damaging Het
Bach1 C A 16: 87,515,736 (GRCm39) Y92* probably null Het
Catsperg1 A C 7: 28,884,907 (GRCm39) C905G probably null Het
Cbr2 T C 11: 120,620,628 (GRCm39) I219V probably benign Het
Ccdc3 A T 2: 5,233,908 (GRCm39) K244I probably damaging Het
Cd226 T C 18: 89,265,433 (GRCm39) V237A probably damaging Het
Chek2 T C 5: 110,989,319 (GRCm39) C81R probably benign Het
Col27a1 T C 4: 63,242,723 (GRCm39) probably null Het
Cracdl T A 1: 37,663,858 (GRCm39) Q680L probably benign Het
Crybg3 A T 16: 59,379,236 (GRCm39) S673T probably benign Het
Csmd2 T A 4: 128,276,743 (GRCm39) Y848* probably null Het
Dgkb C A 12: 38,680,592 (GRCm39) T764K probably damaging Het
Dock4 T A 12: 40,775,648 (GRCm39) C530* probably null Het
Dpyd A G 3: 118,597,780 (GRCm39) K254R probably benign Het
Dstyk C T 1: 132,384,614 (GRCm39) P703S possibly damaging Het
Ehhadh A T 16: 21,585,140 (GRCm39) I247N probably damaging Het
Fer1l5 T G 1: 36,440,558 (GRCm39) L597R probably damaging Het
Fignl1 T C 11: 11,752,842 (GRCm39) E71G probably damaging Het
Fnip2 A C 3: 79,425,421 (GRCm39) V58G probably damaging Het
Gapdhs A T 7: 30,431,349 (GRCm39) I377N probably damaging Het
Gcn1 C T 5: 115,733,359 (GRCm39) A1059V probably damaging Het
Gpd1 G A 15: 99,619,967 (GRCm39) S255N probably damaging Het
Grik2 A C 10: 49,295,792 (GRCm39) I392S probably damaging Het
Hoxb3 T C 11: 96,236,606 (GRCm39) L228P probably damaging Het
Iws1 A T 18: 32,223,568 (GRCm39) M659L probably benign Het
Kmt2c A G 5: 25,580,364 (GRCm39) C570R probably benign Het
Lamc3 T A 2: 31,812,279 (GRCm39) probably null Het
Lipf G A 19: 33,943,048 (GRCm39) G119R probably damaging Het
Lrrc37 T C 11: 103,507,719 (GRCm39) I1416M unknown Het
Magel2 A T 7: 62,028,130 (GRCm39) I345L probably benign Het
Mdn1 G A 4: 32,722,360 (GRCm39) A2381T possibly damaging Het
Med12l T C 3: 59,001,007 (GRCm39) V690A probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,427,071 (GRCm39) probably benign Het
Mob3b A G 4: 35,083,872 (GRCm39) Y106H probably damaging Het
Myo1c T C 11: 75,549,519 (GRCm39) Y166H probably damaging Het
Ndst4 A T 3: 125,364,493 (GRCm39) H390L probably benign Het
Nt5c1b T A 12: 10,425,472 (GRCm39) N280K probably damaging Het
Or10aa1 G A 1: 173,869,900 (GRCm39) R128H probably benign Het
Or5b116 A T 19: 13,423,252 (GRCm39) N292I probably damaging Het
Otof A G 5: 30,527,597 (GRCm39) F1947L probably damaging Het
Pabpc4 G A 4: 123,189,102 (GRCm39) A481T probably benign Het
Parm1 C T 5: 91,741,791 (GRCm39) T53I possibly damaging Het
Pilra C T 5: 137,833,679 (GRCm39) R129Q probably benign Het
Pkd1 C T 17: 24,769,250 (GRCm39) A5V unknown Het
Pmch T C 10: 87,927,242 (GRCm39) S82P probably benign Het
Prf1 G A 10: 61,135,934 (GRCm39) R70H possibly damaging Het
Rad51c T C 11: 87,292,276 (GRCm39) S180G probably benign Het
Rassf8 A C 6: 145,760,973 (GRCm39) T100P probably damaging Het
Rnpepl1 A G 1: 92,844,890 (GRCm39) E394G probably damaging Het
Rufy2 T A 10: 62,838,772 (GRCm39) V418E probably benign Het
Sdad1 A T 5: 92,450,538 (GRCm39) V199D probably damaging Het
Sptbn4 A T 7: 27,063,761 (GRCm39) S2227T probably benign Het
Tac4 A G 11: 95,156,116 (GRCm39) M66V probably benign Het
Tas2r126 T C 6: 42,412,031 (GRCm39) V188A probably benign Het
Tcerg1 T C 18: 42,694,000 (GRCm39) V707A possibly damaging Het
Tmem273 A G 14: 32,527,129 (GRCm39) E32G possibly damaging Het
Trav13d-4 G A 14: 53,995,355 (GRCm39) G103D probably damaging Het
Trav8d-1 A G 14: 53,016,380 (GRCm39) S89G probably benign Het
Ttll4 C T 1: 74,718,572 (GRCm39) S141L probably benign Het
Vash1 T C 12: 86,738,614 (GRCm39) S354P probably benign Het
Vmn2r40 T A 7: 8,911,116 (GRCm39) I726F Het
Wnt6 T C 1: 74,823,422 (GRCm39) F253S probably damaging Het
Zfp599 A G 9: 22,161,811 (GRCm39) I118T probably benign Het
Other mutations in Vmn2r53
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Vmn2r53 APN 7 12,334,835 (GRCm39) missense possibly damaging 0.70
IGL01997:Vmn2r53 APN 7 12,316,373 (GRCm39) missense possibly damaging 0.54
IGL02442:Vmn2r53 APN 7 12,315,656 (GRCm39) missense probably damaging 1.00
IGL02449:Vmn2r53 APN 7 12,316,288 (GRCm39) missense probably damaging 1.00
IGL02589:Vmn2r53 APN 7 12,315,872 (GRCm39) missense possibly damaging 0.93
IGL02986:Vmn2r53 APN 7 12,315,393 (GRCm39) unclassified probably benign
IGL03064:Vmn2r53 APN 7 12,334,937 (GRCm39) missense possibly damaging 0.89
IGL03093:Vmn2r53 APN 7 12,334,791 (GRCm39) missense probably benign 0.03
IGL03244:Vmn2r53 APN 7 12,340,435 (GRCm39) missense probably damaging 1.00
IGL03252:Vmn2r53 APN 7 12,340,318 (GRCm39) missense probably damaging 1.00
IGL03264:Vmn2r53 APN 7 12,315,819 (GRCm39) missense possibly damaging 0.95
IGL03293:Vmn2r53 APN 7 12,332,349 (GRCm39) missense probably benign 0.34
R0109:Vmn2r53 UTSW 7 12,315,993 (GRCm39) missense probably damaging 1.00
R0453:Vmn2r53 UTSW 7 12,316,338 (GRCm39) missense probably damaging 1.00
R0735:Vmn2r53 UTSW 7 12,315,707 (GRCm39) missense probably benign
R0881:Vmn2r53 UTSW 7 12,334,859 (GRCm39) missense probably benign 0.01
R0894:Vmn2r53 UTSW 7 12,335,141 (GRCm39) missense probably benign 0.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0973:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0974:Vmn2r53 UTSW 7 12,335,319 (GRCm39) missense probably damaging 1.00
R0990:Vmn2r53 UTSW 7 12,315,429 (GRCm39) missense probably benign
R1102:Vmn2r53 UTSW 7 12,332,410 (GRCm39) missense possibly damaging 0.94
R1141:Vmn2r53 UTSW 7 12,334,673 (GRCm39) missense possibly damaging 0.54
R1263:Vmn2r53 UTSW 7 12,315,533 (GRCm39) missense probably benign 0.41
R1343:Vmn2r53 UTSW 7 12,318,701 (GRCm39) missense probably benign 0.08
R1750:Vmn2r53 UTSW 7 12,315,632 (GRCm39) missense probably damaging 1.00
R1836:Vmn2r53 UTSW 7 12,334,812 (GRCm39) missense probably damaging 1.00
R2035:Vmn2r53 UTSW 7 12,332,438 (GRCm39) missense possibly damaging 0.76
R2202:Vmn2r53 UTSW 7 12,335,366 (GRCm39) missense probably damaging 1.00
R3707:Vmn2r53 UTSW 7 12,315,981 (GRCm39) missense possibly damaging 0.95
R4372:Vmn2r53 UTSW 7 12,315,656 (GRCm39) missense probably damaging 0.98
R4615:Vmn2r53 UTSW 7 12,316,229 (GRCm39) missense probably damaging 1.00
R4655:Vmn2r53 UTSW 7 12,315,932 (GRCm39) missense possibly damaging 0.83
R4663:Vmn2r53 UTSW 7 12,334,901 (GRCm39) missense probably benign 0.21
R4708:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4710:Vmn2r53 UTSW 7 12,335,129 (GRCm39) missense probably benign
R4774:Vmn2r53 UTSW 7 12,334,692 (GRCm39) nonsense probably null
R4859:Vmn2r53 UTSW 7 12,335,330 (GRCm39) missense probably damaging 1.00
R5061:Vmn2r53 UTSW 7 12,315,741 (GRCm39) missense probably benign 0.01
R5561:Vmn2r53 UTSW 7 12,335,347 (GRCm39) missense probably damaging 1.00
R5729:Vmn2r53 UTSW 7 12,334,733 (GRCm39) missense probably damaging 1.00
R6004:Vmn2r53 UTSW 7 12,316,328 (GRCm39) missense probably benign 0.12
R6083:Vmn2r53 UTSW 7 12,315,808 (GRCm39) missense probably benign
R6312:Vmn2r53 UTSW 7 12,332,566 (GRCm39) critical splice acceptor site probably null
R6700:Vmn2r53 UTSW 7 12,315,633 (GRCm39) missense probably damaging 0.96
R6783:Vmn2r53 UTSW 7 12,335,360 (GRCm39) missense probably damaging 1.00
R6852:Vmn2r53 UTSW 7 12,340,441 (GRCm39) missense probably damaging 0.99
R6889:Vmn2r53 UTSW 7 12,335,069 (GRCm39) missense probably benign 0.10
R6940:Vmn2r53 UTSW 7 12,316,343 (GRCm39) missense probably benign 0.19
R7100:Vmn2r53 UTSW 7 12,315,513 (GRCm39) nonsense probably null
R7174:Vmn2r53 UTSW 7 12,315,628 (GRCm39) missense probably benign 0.01
R7213:Vmn2r53 UTSW 7 12,334,983 (GRCm39) missense probably benign 0.17
R7276:Vmn2r53 UTSW 7 12,340,359 (GRCm39) missense probably damaging 0.99
R7515:Vmn2r53 UTSW 7 12,315,846 (GRCm39) missense probably benign 0.05
R7678:Vmn2r53 UTSW 7 12,332,425 (GRCm39) missense probably benign 0.04
R7843:Vmn2r53 UTSW 7 12,316,026 (GRCm39) missense probably damaging 1.00
R8208:Vmn2r53 UTSW 7 12,335,322 (GRCm39) missense probably damaging 1.00
R8211:Vmn2r53 UTSW 7 12,315,843 (GRCm39) missense probably benign 0.01
R8478:Vmn2r53 UTSW 7 12,340,281 (GRCm39) missense probably benign 0.01
R8853:Vmn2r53 UTSW 7 12,315,737 (GRCm39) missense probably damaging 1.00
R8924:Vmn2r53 UTSW 7 12,334,752 (GRCm39) missense probably benign 0.17
R8963:Vmn2r53 UTSW 7 12,315,926 (GRCm39) missense probably damaging 1.00
R9042:Vmn2r53 UTSW 7 12,315,435 (GRCm39) missense probably benign
R9076:Vmn2r53 UTSW 7 12,340,231 (GRCm39) missense probably damaging 1.00
R9407:Vmn2r53 UTSW 7 12,335,124 (GRCm39) missense probably damaging 0.99
R9690:Vmn2r53 UTSW 7 12,315,912 (GRCm39) missense probably damaging 1.00
Z1176:Vmn2r53 UTSW 7 12,335,231 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAACTTGTACAGCCCCAG -3'
(R):5'- ACAAGCGTTTGAGGAGATGTAC -3'

Sequencing Primer
(F):5'- TTGTACAGCCCCAGAAGTCTG -3'
(R):5'- GCGTTTGAGGAGATGTACATTTTTAC -3'
Posted On 2019-11-12