Incidental Mutation 'R7715:Emc1'
ID594836
Institutional Source Beutler Lab
Gene Symbol Emc1
Ensembl Gene ENSMUSG00000078517
Gene NameER membrane protein complex subunit 1
SynonymsC230096C10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R7715 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location139352587-139378730 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 139371623 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 806 (R806C)
Ref Sequence ENSEMBL: ENSMUSP00000080888 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042096] [ENSMUST00000082262] [ENSMUST00000147999] [ENSMUST00000155700] [ENSMUST00000179784]
Predicted Effect probably damaging
Transcript: ENSMUST00000042096
AA Change: R803C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049034
Gene: ENSMUSG00000078517
AA Change: R803C

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 787 993 1.1e-66 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000082262
AA Change: R806C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080888
Gene: ENSMUSG00000078517
AA Change: R806C

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 4.7e-10 PFAM
Pfam:DUF1620 791 996 1.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147999
SMART Domains Protein: ENSMUSP00000117419
Gene: ENSMUSG00000066036

DomainStartEndE-ValueType
low complexity region 170 226 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Pfam:E3_UbLigase_R4 1205 1301 4.5e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155700
Predicted Effect probably damaging
Transcript: ENSMUST00000179784
AA Change: R806C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137103
Gene: ENSMUSG00000078517
AA Change: R806C

DomainStartEndE-ValueType
Pfam:PQQ_2 21 258 5.3e-9 PFAM
Pfam:DUF1620 790 996 1.1e-66 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I transmembrane protein, which is a subunit of the endoplasmic reticulum membrane protein complex (EMC). Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
C330027C09Rik A T 16: 49,013,984 Q643L probably damaging Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Cyp2b23 T C 7: 26,681,695 Y79C probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Epg5 G A 18: 77,968,586 R816Q probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Fchsd1 A T 18: 37,966,642 probably null Het
Foxp1 T C 6: 98,945,660 T404A unknown Het
Fra10ac1 T C 19: 38,189,838 E299G probably damaging Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Gpam A C 19: 55,088,921 V146G probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Lrrc17 A T 5: 21,561,080 N187Y probably damaging Het
Macc1 C T 12: 119,446,256 A253V possibly damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Nlrp3 T A 11: 59,543,003 probably null Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Sh3gl2 T A 4: 85,398,840 probably null Het
Slc24a4 A G 12: 102,218,960 M93V possibly damaging Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Ttk A G 9: 83,865,153 T682A probably benign Het
Virma C T 4: 11,549,682 R1807W probably damaging Het
Virma A G 4: 11,513,016 probably null Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in Emc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Emc1 APN 4 139355082 splice site probably benign
IGL00898:Emc1 APN 4 139371630 missense probably damaging 1.00
IGL01481:Emc1 APN 4 139362099 missense probably benign 0.00
IGL02174:Emc1 APN 4 139371668 missense possibly damaging 0.95
IGL02264:Emc1 APN 4 139375464 missense probably damaging 1.00
IGL02501:Emc1 APN 4 139370984 missense probably benign 0.00
IGL02697:Emc1 APN 4 139352644 missense probably benign
IGL03355:Emc1 APN 4 139371593 splice site probably benign
IGL03386:Emc1 APN 4 139363781 critical splice donor site probably null
PIT4480001:Emc1 UTSW 4 139359277 missense possibly damaging 0.69
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0023:Emc1 UTSW 4 139371009 missense probably damaging 1.00
R0051:Emc1 UTSW 4 139375163 missense possibly damaging 0.81
R0094:Emc1 UTSW 4 139360485 missense probably damaging 0.99
R0613:Emc1 UTSW 4 139375072 splice site probably benign
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1464:Emc1 UTSW 4 139370937 missense probably damaging 0.97
R1512:Emc1 UTSW 4 139360184 splice site probably null
R1702:Emc1 UTSW 4 139375201 missense probably damaging 1.00
R1839:Emc1 UTSW 4 139360485 missense probably damaging 0.98
R1843:Emc1 UTSW 4 139375512 missense probably benign 0.02
R1850:Emc1 UTSW 4 139359373 splice site probably benign
R2024:Emc1 UTSW 4 139360946 missense possibly damaging 0.95
R2196:Emc1 UTSW 4 139366530 missense probably benign 0.08
R2912:Emc1 UTSW 4 139365260 missense possibly damaging 0.51
R3696:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3697:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3698:Emc1 UTSW 4 139365386 missense possibly damaging 0.46
R3803:Emc1 UTSW 4 139367163 missense possibly damaging 0.91
R3923:Emc1 UTSW 4 139363185 nonsense probably null
R4738:Emc1 UTSW 4 139362202 missense possibly damaging 0.52
R4914:Emc1 UTSW 4 139375165 nonsense probably null
R5033:Emc1 UTSW 4 139371696 missense probably damaging 1.00
R5322:Emc1 UTSW 4 139354246 missense probably damaging 1.00
R5375:Emc1 UTSW 4 139366491 missense probably damaging 0.96
R5483:Emc1 UTSW 4 139375376 missense probably damaging 1.00
R5587:Emc1 UTSW 4 139362148 missense probably damaging 0.98
R5687:Emc1 UTSW 4 139375380 missense probably damaging 1.00
R5938:Emc1 UTSW 4 139357620 missense probably benign
R6056:Emc1 UTSW 4 139354222 missense possibly damaging 0.51
R6170:Emc1 UTSW 4 139366378 missense probably benign 0.01
R6174:Emc1 UTSW 4 139366531 missense probably benign 0.01
R6208:Emc1 UTSW 4 139354271 missense probably damaging 0.99
R6340:Emc1 UTSW 4 139365563 missense probably damaging 1.00
R6371:Emc1 UTSW 4 139371665 nonsense probably null
R6889:Emc1 UTSW 4 139365350 missense probably damaging 0.97
R7592:Emc1 UTSW 4 139360566 missense probably benign 0.00
R7699:Emc1 UTSW 4 139354870 missense probably benign
R7984:Emc1 UTSW 4 139375449 missense probably damaging 1.00
R8112:Emc1 UTSW 4 139367187 missense probably benign 0.00
R8325:Emc1 UTSW 4 139365210 missense possibly damaging 0.94
R8387:Emc1 UTSW 4 139361289 missense probably benign
R8751:Emc1 UTSW 4 139369968 missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- AGCCTAGACAAAGCCGTTAGTG -3'
(R):5'- AGTGGCTCATGAAATCCAGC -3'

Sequencing Primer
(F):5'- AGCCGTTAGTGATGGAAGTTAG -3'
(R):5'- GTGGCTCATGAAATCCAGCACTAAG -3'
Posted On2019-11-12