Incidental Mutation 'R7715:Foxp1'
ID594844
Institutional Source Beutler Lab
Gene Symbol Foxp1
Ensembl Gene ENSMUSG00000030067
Gene Nameforkhead box P1
Synonyms4932443N09Rik, 3110052D19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7715 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location98925338-99522721 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98945660 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 404 (T404A)
Ref Sequence ENSEMBL: ENSMUSP00000108952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074346] [ENSMUST00000113322] [ENSMUST00000113324] [ENSMUST00000113326] [ENSMUST00000113328] [ENSMUST00000113329] [ENSMUST00000124058] [ENSMUST00000176565] [ENSMUST00000176632] [ENSMUST00000176850] [ENSMUST00000177229] [ENSMUST00000177230] [ENSMUST00000177307] [ENSMUST00000177437]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074346
AA Change: T436A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073953
Gene: ENSMUSG00000030067
AA Change: T436A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113322
AA Change: T436A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108948
Gene: ENSMUSG00000030067
AA Change: T436A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113324
AA Change: T437A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000108950
Gene: ENSMUSG00000030067
AA Change: T437A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000113326
AA Change: T404A
SMART Domains Protein: ENSMUSP00000108952
Gene: ENSMUSG00000030067
AA Change: T404A

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 201 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 232 243 N/A INTRINSIC
low complexity region 285 298 N/A INTRINSIC
ZnF_C2H2 302 327 8.67e-1 SMART
low complexity region 339 351 N/A INTRINSIC
low complexity region 400 414 N/A INTRINSIC
FH 459 540 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113328
AA Change: T437A

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108954
Gene: ENSMUSG00000030067
AA Change: T437A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113329
AA Change: T436A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108955
Gene: ENSMUSG00000030067
AA Change: T436A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 233 N/A INTRINSIC
low complexity region 236 250 N/A INTRINSIC
low complexity region 264 275 N/A INTRINSIC
low complexity region 317 330 N/A INTRINSIC
ZnF_C2H2 334 359 8.67e-1 SMART
low complexity region 371 383 N/A INTRINSIC
low complexity region 432 446 N/A INTRINSIC
FH 491 579 1.76e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124058
AA Change: T307A

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120244
Gene: ENSMUSG00000030067
AA Change: T307A

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 188 201 N/A INTRINSIC
ZnF_C2H2 205 230 8.67e-1 SMART
low complexity region 242 254 N/A INTRINSIC
low complexity region 303 317 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176565
AA Change: T437A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135181
Gene: ENSMUSG00000030067
AA Change: T437A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 191 N/A INTRINSIC
low complexity region 200 234 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 318 331 N/A INTRINSIC
ZnF_C2H2 335 360 8.67e-1 SMART
low complexity region 372 384 N/A INTRINSIC
low complexity region 433 447 N/A INTRINSIC
FH 491 572 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176632
AA Change: T405A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135635
Gene: ENSMUSG00000030067
AA Change: T405A

DomainStartEndE-ValueType
low complexity region 108 159 N/A INTRINSIC
low complexity region 168 202 N/A INTRINSIC
low complexity region 205 219 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
ZnF_C2H2 303 328 8.67e-1 SMART
low complexity region 340 352 N/A INTRINSIC
low complexity region 401 415 N/A INTRINSIC
FH 460 541 2.07e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176850
AA Change: T406A

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135041
Gene: ENSMUSG00000030067
AA Change: T406A

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177229
AA Change: T308A

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134817
Gene: ENSMUSG00000030067
AA Change: T308A

DomainStartEndE-ValueType
low complexity region 10 62 N/A INTRINSIC
low complexity region 71 105 N/A INTRINSIC
low complexity region 108 122 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
low complexity region 189 202 N/A INTRINSIC
ZnF_C2H2 206 231 8.67e-1 SMART
low complexity region 243 255 N/A INTRINSIC
low complexity region 304 318 N/A INTRINSIC
FH 363 444 2.07e-39 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000177230
AA Change: T406A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000135098
Gene: ENSMUSG00000030067
AA Change: T406A

DomainStartEndE-ValueType
low complexity region 108 160 N/A INTRINSIC
low complexity region 169 203 N/A INTRINSIC
low complexity region 206 220 N/A INTRINSIC
low complexity region 234 245 N/A INTRINSIC
low complexity region 287 300 N/A INTRINSIC
ZnF_C2H2 304 329 8.67e-1 SMART
low complexity region 341 353 N/A INTRINSIC
low complexity region 402 416 N/A INTRINSIC
FH 461 542 2.07e-39 SMART
Predicted Effect unknown
Transcript: ENSMUST00000177307
AA Change: T438A
SMART Domains Protein: ENSMUSP00000135764
Gene: ENSMUSG00000030067
AA Change: T438A

DomainStartEndE-ValueType
coiled coil region 62 113 N/A INTRINSIC
low complexity region 140 192 N/A INTRINSIC
low complexity region 201 235 N/A INTRINSIC
low complexity region 238 252 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
ZnF_C2H2 336 361 8.67e-1 SMART
low complexity region 373 385 N/A INTRINSIC
low complexity region 434 448 N/A INTRINSIC
FH 492 573 2.07e-39 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177437
AA Change: T307A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135809
Gene: ENSMUSG00000030067
AA Change: T307A

DomainStartEndE-ValueType
low complexity region 10 61 N/A INTRINSIC
low complexity region 70 104 N/A INTRINSIC
low complexity region 107 121 N/A INTRINSIC
low complexity region 135 146 N/A INTRINSIC
low complexity region 188 201 N/A INTRINSIC
ZnF_C2H2 205 230 8.67e-1 SMART
low complexity region 242 254 N/A INTRINSIC
low complexity region 303 317 N/A INTRINSIC
FH 362 443 2.07e-39 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Homozygous null mice display embryonic lethality with abnormal outflow tract septation, ventricular septal defects, abnormal cardiac valve morphology, decreased and irregular heart rate, thin ventricular compact zone, and edema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
C330027C09Rik A T 16: 49,013,984 Q643L probably damaging Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Cyp2b23 T C 7: 26,681,695 Y79C probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Emc1 C T 4: 139,371,623 R806C probably damaging Het
Epg5 G A 18: 77,968,586 R816Q probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Fchsd1 A T 18: 37,966,642 probably null Het
Fra10ac1 T C 19: 38,189,838 E299G probably damaging Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Gpam A C 19: 55,088,921 V146G probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Lrrc17 A T 5: 21,561,080 N187Y probably damaging Het
Macc1 C T 12: 119,446,256 A253V possibly damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Nlrp3 T A 11: 59,543,003 probably null Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Sh3gl2 T A 4: 85,398,840 probably null Het
Slc24a4 A G 12: 102,218,960 M93V possibly damaging Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Ttk A G 9: 83,865,153 T682A probably benign Het
Virma C T 4: 11,549,682 R1807W probably damaging Het
Virma A G 4: 11,513,016 probably null Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in Foxp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02191:Foxp1 APN 6 98945600 missense probably damaging 0.99
IGL02330:Foxp1 APN 6 98945412 missense probably damaging 1.00
IGL02869:Foxp1 APN 6 98930083 utr 3 prime probably benign
IGL02968:Foxp1 APN 6 99075861 missense probably damaging 1.00
Foxy UTSW 6 99015510 nonsense probably null
Moxie UTSW 6 99015514 critical splice acceptor site probably null
Roxie UTSW 6 98941634 missense unknown
R0037:Foxp1 UTSW 6 99162969 missense probably damaging 1.00
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0063:Foxp1 UTSW 6 98944723 splice site probably benign
R0427:Foxp1 UTSW 6 98930203 missense probably damaging 1.00
R0601:Foxp1 UTSW 6 98930122 missense probably damaging 1.00
R1356:Foxp1 UTSW 6 99016676 splice site probably benign
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1468:Foxp1 UTSW 6 98978220 missense possibly damaging 0.62
R1548:Foxp1 UTSW 6 98945420 missense probably damaging 1.00
R1696:Foxp1 UTSW 6 98945702 missense probably benign 0.18
R1933:Foxp1 UTSW 6 99075965 small deletion probably benign
R2152:Foxp1 UTSW 6 99016541 missense probably damaging 0.99
R2338:Foxp1 UTSW 6 99003293 missense possibly damaging 0.61
R3896:Foxp1 UTSW 6 99075936 missense probably benign 0.33
R5006:Foxp1 UTSW 6 99162858 missense probably damaging 0.98
R5143:Foxp1 UTSW 6 98945532 critical splice donor site probably null
R5428:Foxp1 UTSW 6 99016631 missense probably damaging 1.00
R5765:Foxp1 UTSW 6 99015462 missense probably damaging 0.99
R5816:Foxp1 UTSW 6 99075965 small deletion probably benign
R6172:Foxp1 UTSW 6 99015510 nonsense probably null
R6172:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6173:Foxp1 UTSW 6 99015510 nonsense probably null
R6173:Foxp1 UTSW 6 99015514 critical splice acceptor site probably null
R6175:Foxp1 UTSW 6 98966076 missense probably damaging 1.00
R6776:Foxp1 UTSW 6 99075965 small deletion probably benign
R6782:Foxp1 UTSW 6 98930145 missense probably damaging 1.00
R7229:Foxp1 UTSW 6 98935412 missense unknown
R7559:Foxp1 UTSW 6 98945560 missense unknown
R8007:Foxp1 UTSW 6 98941634 missense unknown
R8099:Foxp1 UTSW 6 98945549 missense unknown
R8317:Foxp1 UTSW 6 99075905 small deletion probably benign
R8408:Foxp1 UTSW 6 98945582 missense unknown
R8704:Foxp1 UTSW 6 99016546 missense unknown
R8705:Foxp1 UTSW 6 99016546 missense unknown
R9014:Foxp1 UTSW 6 99075905 small deletion probably benign
X0066:Foxp1 UTSW 6 99076015 nonsense probably null
Z1177:Foxp1 UTSW 6 98978161 missense unknown
Predicted Primers PCR Primer
(F):5'- AACTGCAGATTCCCCATGCC -3'
(R):5'- TACCAGTTTGGAGAGGTAACCC -3'

Sequencing Primer
(F):5'- ATTCCCCATGCCGCCCC -3'
(R):5'- CAGTCTTTCCTCTGGGACAAGAGAG -3'
Posted On2019-11-12