Incidental Mutation 'R7715:Cyp2b23'
ID594848
Institutional Source Beutler Lab
Gene Symbol Cyp2b23
Ensembl Gene ENSMUSG00000040650
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 23
SynonymsEG243881
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R7715 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26665227-26686437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26681695 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 79 (Y79C)
Ref Sequence ENSEMBL: ENSMUSP00000076578 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077356]
Predicted Effect probably benign
Transcript: ENSMUST00000077356
AA Change: Y79C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076578
Gene: ENSMUSG00000040650
AA Change: Y79C

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:p450 31 488 2.9e-148 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
C330027C09Rik A T 16: 49,013,984 Q643L probably damaging Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Emc1 C T 4: 139,371,623 R806C probably damaging Het
Epg5 G A 18: 77,968,586 R816Q probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Fchsd1 A T 18: 37,966,642 probably null Het
Foxp1 T C 6: 98,945,660 T404A unknown Het
Fra10ac1 T C 19: 38,189,838 E299G probably damaging Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Gpam A C 19: 55,088,921 V146G probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Lrrc17 A T 5: 21,561,080 N187Y probably damaging Het
Macc1 C T 12: 119,446,256 A253V possibly damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Nlrp3 T A 11: 59,543,003 probably null Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Sh3gl2 T A 4: 85,398,840 probably null Het
Slc24a4 A G 12: 102,218,960 M93V possibly damaging Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Ttk A G 9: 83,865,153 T682A probably benign Het
Virma C T 4: 11,549,682 R1807W probably damaging Het
Virma A G 4: 11,513,016 probably null Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in Cyp2b23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01716:Cyp2b23 APN 7 26679490 missense probably damaging 0.98
IGL01879:Cyp2b23 APN 7 26672854 missense probably benign 0.04
IGL02207:Cyp2b23 APN 7 26681755 missense probably damaging 1.00
IGL03047:Cyp2b23 APN 7 26681467 splice site probably benign
R0117:Cyp2b23 UTSW 7 26673114 missense probably benign 0.25
R0265:Cyp2b23 UTSW 7 26672879 splice site probably benign
R1457:Cyp2b23 UTSW 7 26673149 missense probably damaging 1.00
R1605:Cyp2b23 UTSW 7 26686418 missense probably benign 0.02
R1639:Cyp2b23 UTSW 7 26686417 missense possibly damaging 0.77
R1741:Cyp2b23 UTSW 7 26673077 missense possibly damaging 0.94
R2042:Cyp2b23 UTSW 7 26666108 missense probably damaging 1.00
R3911:Cyp2b23 UTSW 7 26681417 missense probably benign 0.02
R4078:Cyp2b23 UTSW 7 26673092 missense probably damaging 1.00
R4279:Cyp2b23 UTSW 7 26666027 missense possibly damaging 0.89
R4668:Cyp2b23 UTSW 7 26672734 missense probably damaging 1.00
R5419:Cyp2b23 UTSW 7 26681423 nonsense probably null
R5516:Cyp2b23 UTSW 7 26673057 nonsense probably null
R5723:Cyp2b23 UTSW 7 26681396 missense probably benign 0.41
R5873:Cyp2b23 UTSW 7 26675006 missense probably benign 0.02
R6346:Cyp2b23 UTSW 7 26681725 missense probably damaging 0.98
R6977:Cyp2b23 UTSW 7 26681320 missense possibly damaging 0.87
R7131:Cyp2b23 UTSW 7 26681413 missense probably benign 0.25
R7181:Cyp2b23 UTSW 7 26674403 missense probably damaging 1.00
R7877:Cyp2b23 UTSW 7 26686426 missense probably damaging 0.97
R7880:Cyp2b23 UTSW 7 26673134 missense probably damaging 1.00
R8004:Cyp2b23 UTSW 7 26679466 missense probably benign
R8072:Cyp2b23 UTSW 7 26666006 missense probably damaging 1.00
R8083:Cyp2b23 UTSW 7 26686403 missense possibly damaging 0.62
Z1088:Cyp2b23 UTSW 7 26681411 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TAGGTCACACTGGAATCCCC -3'
(R):5'- CAACTCTTAGGTCTTCTGAAGGGG -3'

Sequencing Primer
(F):5'- TGGAATCCCCAGGCCTTC -3'
(R):5'- TCTTCTGAAGGGGAAGGGTAGC -3'
Posted On2019-11-12