Incidental Mutation 'R7715:Ttk'
ID594859
Institutional Source Beutler Lab
Gene Symbol Ttk
Ensembl Gene ENSMUSG00000038379
Gene NameTtk protein kinase
SynonymsMps1, Esk1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.950) question?
Stock #R7715 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location83834689-83872389 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83865153 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 682 (T682A)
Ref Sequence ENSEMBL: ENSMUSP00000064839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070326] [ENSMUST00000185913]
Predicted Effect probably benign
Transcript: ENSMUST00000070326
AA Change: T682A

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000064839
Gene: ENSMUSG00000038379
AA Change: T682A

DomainStartEndE-ValueType
PDB:4B94|D 55 235 7e-97 PDB
low complexity region 459 487 N/A INTRINSIC
S_TKc 498 764 1.14e-77 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185913
SMART Domains Protein: ENSMUSP00000139956
Gene: ENSMUSG00000038379

DomainStartEndE-ValueType
PDB:4B94|D 55 235 2e-97 PDB
low complexity region 459 487 N/A INTRINSIC
Pfam:Pkinase 498 661 7.9e-36 PFAM
Pfam:Pkinase_Tyr 498 661 6.8e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual specificity protein kinase with the ability to phosphorylate tyrosine, serine and threonine. Associated with cell proliferation, this protein is essential for chromosome alignment at the centromere during mitosis and is required for centrosome duplication. It has been found to be a critical mitotic checkpoint protein for accurate segregation of chromosomes during mitosis. Tumorigenesis may occur when this protein fails to degrade and produces excess centrosomes resulting in aberrant mitotic spindles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a floxed allele activated in oocytes exhibit reduced female fertility associated with defective spindle assembly checkpoint, premature chromosome segregation, and accelerated anaphase and polar body extrusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
C330027C09Rik A T 16: 49,013,984 Q643L probably damaging Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Cyp2b23 T C 7: 26,681,695 Y79C probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Emc1 C T 4: 139,371,623 R806C probably damaging Het
Epg5 G A 18: 77,968,586 R816Q probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Foxp1 T C 6: 98,945,660 T404A unknown Het
Fra10ac1 T C 19: 38,189,838 E299G probably damaging Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Gpam A C 19: 55,088,921 V146G probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Lrrc17 A T 5: 21,561,080 N187Y probably damaging Het
Macc1 C T 12: 119,446,256 A253V possibly damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Slc24a4 A G 12: 102,218,960 M93V possibly damaging Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Virma C T 4: 11,549,682 R1807W probably damaging Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in Ttk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00721:Ttk APN 9 83863448 missense probably damaging 1.00
IGL01298:Ttk APN 9 83865142 missense probably benign 0.27
IGL02806:Ttk APN 9 83862487 nonsense probably null
IGL03080:Ttk APN 9 83843083 missense probably damaging 1.00
R0396:Ttk UTSW 9 83847260 unclassified probably benign
R0507:Ttk UTSW 9 83868067 missense probably damaging 0.97
R0827:Ttk UTSW 9 83843915 missense probably benign
R1077:Ttk UTSW 9 83844149 unclassified probably benign
R1730:Ttk UTSW 9 83868592 missense possibly damaging 0.86
R1844:Ttk UTSW 9 83854862 missense possibly damaging 0.55
R1856:Ttk UTSW 9 83869263 missense probably damaging 1.00
R1941:Ttk UTSW 9 83853126 missense probably benign 0.22
R2191:Ttk UTSW 9 83862183 missense probably damaging 0.99
R3737:Ttk UTSW 9 83854837 missense possibly damaging 0.88
R4035:Ttk UTSW 9 83854837 missense possibly damaging 0.88
R4903:Ttk UTSW 9 83865148 missense probably benign 0.42
R4908:Ttk UTSW 9 83843686 missense possibly damaging 0.96
R4966:Ttk UTSW 9 83865148 missense probably benign 0.42
R5023:Ttk UTSW 9 83863541 missense probably damaging 1.00
R5197:Ttk UTSW 9 83839341 missense probably benign
R5567:Ttk UTSW 9 83862535 missense possibly damaging 0.94
R6022:Ttk UTSW 9 83839322 missense probably damaging 1.00
R6900:Ttk UTSW 9 83872030 missense probably damaging 0.96
R7039:Ttk UTSW 9 83868092 missense probably damaging 1.00
R7373:Ttk UTSW 9 83854877 missense probably benign 0.00
R7846:Ttk UTSW 9 83843679 missense probably benign 0.27
R7929:Ttk UTSW 9 83843679 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TGTACCTGGGATGGGATAGTAC -3'
(R):5'- AGAAACTGGGCCCCTGATAAG -3'

Sequencing Primer
(F):5'- CCTGGGATGGGATAGTACATACATTC -3'
(R):5'- CTGATAAGGGACATCAGGGAAGC -3'
Posted On2019-11-12