Incidental Mutation 'R7715:Slc24a4'
ID594875
Institutional Source Beutler Lab
Gene Symbol Slc24a4
Ensembl Gene ENSMUSG00000041771
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 4
SynonymsNCKX4, A930002M03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7715 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location102128733-102267091 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102218960 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 93 (M93V)
Ref Sequence ENSEMBL: ENSMUSP00000078030 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079020] [ENSMUST00000159329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079020
AA Change: M93V

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000078030
Gene: ENSMUSG00000041771
AA Change: M93V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Na_Ca_ex 86 229 2.4e-31 PFAM
low complexity region 367 388 N/A INTRINSIC
Pfam:Na_Ca_ex 435 587 2.4e-30 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159329
AA Change: M110V

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124513
Gene: ENSMUSG00000041771
AA Change: M110V

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Na_Ca_ex 113 245 1e-32 PFAM
low complexity region 365 386 N/A INTRINSIC
Pfam:Na_Ca_ex 443 562 1.4e-21 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000125012
Gene: ENSMUSG00000041771
AA Change: M109V

DomainStartEndE-ValueType
transmembrane domain 23 45 N/A INTRINSIC
Pfam:Na_Ca_ex 103 246 1.3e-31 PFAM
low complexity region 365 386 N/A INTRINSIC
Pfam:Na_Ca_ex 433 585 1.3e-30 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired olfactory response and reduced weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
C330027C09Rik A T 16: 49,013,984 Q643L probably damaging Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Cyp2b23 T C 7: 26,681,695 Y79C probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Emc1 C T 4: 139,371,623 R806C probably damaging Het
Epg5 G A 18: 77,968,586 R816Q probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Fchsd1 A T 18: 37,966,642 probably null Het
Foxp1 T C 6: 98,945,660 T404A unknown Het
Fra10ac1 T C 19: 38,189,838 E299G probably damaging Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Gpam A C 19: 55,088,921 V146G probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Lrrc17 A T 5: 21,561,080 N187Y probably damaging Het
Macc1 C T 12: 119,446,256 A253V possibly damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Nlrp3 T A 11: 59,543,003 probably null Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Sh3gl2 T A 4: 85,398,840 probably null Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Ttk A G 9: 83,865,153 T682A probably benign Het
Virma C T 4: 11,549,682 R1807W probably damaging Het
Virma A G 4: 11,513,016 probably null Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in Slc24a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Slc24a4 APN 12 102223635 missense probably benign 0.09
IGL01724:Slc24a4 APN 12 102218960 missense possibly damaging 0.78
IGL01767:Slc24a4 APN 12 102223687 splice site probably benign
IGL01814:Slc24a4 APN 12 102254618 missense probably benign 0.00
IGL02047:Slc24a4 APN 12 102254623 missense probably damaging 1.00
IGL02449:Slc24a4 APN 12 102227082 missense probably benign 0.00
IGL02632:Slc24a4 APN 12 102234682 missense probably benign 0.15
IGL03251:Slc24a4 APN 12 102222825 missense probably damaging 0.98
spindly UTSW 12 102264944 critical splice donor site probably null
R0207:Slc24a4 UTSW 12 102228951 critical splice donor site probably null
R0284:Slc24a4 UTSW 12 102260481 missense probably damaging 1.00
R0506:Slc24a4 UTSW 12 102131623 critical splice donor site probably null
R1903:Slc24a4 UTSW 12 102131617 missense probably benign 0.00
R2004:Slc24a4 UTSW 12 102213907 missense probably damaging 1.00
R2126:Slc24a4 UTSW 12 102222759 missense probably damaging 1.00
R2518:Slc24a4 UTSW 12 102222051 missense probably benign 0.02
R3498:Slc24a4 UTSW 12 102234692 missense probably benign
R3620:Slc24a4 UTSW 12 102218963 missense probably damaging 1.00
R3621:Slc24a4 UTSW 12 102218963 missense probably damaging 1.00
R4917:Slc24a4 UTSW 12 102264944 critical splice donor site probably null
R5028:Slc24a4 UTSW 12 102264370 missense probably damaging 1.00
R5886:Slc24a4 UTSW 12 102260415 missense probably damaging 1.00
R5914:Slc24a4 UTSW 12 102234790 missense probably damaging 1.00
R6257:Slc24a4 UTSW 12 102254510 missense probably benign 0.00
R6305:Slc24a4 UTSW 12 102222101 missense possibly damaging 0.84
R6313:Slc24a4 UTSW 12 102254510 missense probably benign 0.00
R6734:Slc24a4 UTSW 12 102219000 missense probably damaging 1.00
R7378:Slc24a4 UTSW 12 102239176 missense probably benign 0.06
R7419:Slc24a4 UTSW 12 102227091 critical splice donor site probably null
R7529:Slc24a4 UTSW 12 102264448 missense probably benign 0.01
R7781:Slc24a4 UTSW 12 102234853 critical splice donor site probably null
R8258:Slc24a4 UTSW 12 102254669 missense probably damaging 1.00
R8259:Slc24a4 UTSW 12 102254669 missense probably damaging 1.00
R8766:Slc24a4 UTSW 12 102230452 missense probably benign 0.00
R8811:Slc24a4 UTSW 12 102213874 missense probably damaging 1.00
Z1176:Slc24a4 UTSW 12 102228898 missense probably damaging 1.00
Z1176:Slc24a4 UTSW 12 102239238 missense probably benign 0.01
Z1177:Slc24a4 UTSW 12 102260420 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCATACTCTGCGACAGTGCTG -3'
(R):5'- TGTCATGATCTTCCACACCAGAG -3'

Sequencing Primer
(F):5'- GACCCAGCTCAGCATTCGATTTC -3'
(R):5'- ACCAGAGTGCTTCCTGTCC -3'
Posted On2019-11-12