Incidental Mutation 'R7715:Macc1'
ID594876
Institutional Source Beutler Lab
Gene Symbol Macc1
Ensembl Gene ENSMUSG00000041886
Gene Namemetastasis associated in colon cancer 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7715 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location119314270-119469987 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119446256 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 253 (A253V)
Ref Sequence ENSEMBL: ENSMUSP00000042955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048880] [ENSMUST00000221866] [ENSMUST00000221917] [ENSMUST00000222058] [ENSMUST00000222784]
Predicted Effect possibly damaging
Transcript: ENSMUST00000048880
AA Change: A253V

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042955
Gene: ENSMUSG00000041886
AA Change: A253V

DomainStartEndE-ValueType
low complexity region 127 141 N/A INTRINSIC
Pfam:ZU5 213 307 3.5e-10 PFAM
SH3 551 617 3.74e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000221866
AA Change: A253V

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000221917
AA Change: A253V

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222058
AA Change: A253V

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222784
AA Change: A253V

PolyPhen 2 Score 0.722 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MACC1 is a key regulator of the hepatocyte growth factor (HGF; MIM 142409)-HGF receptor (HGFR, or MET; MIM 164860) pathway, which is involved in cellular growth, epithelial-mesenchymal transition, angiogenesis, cell motility, invasiveness, and metastasis. Expression of MACC1 in colon cancer (MIM 114500) specimens is an independent prognostic indicator for metastasis formation and metastasis-free survival (Stein et al., 2009 [PubMed 19098908]).[supplied by OMIM, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
C330027C09Rik A T 16: 49,013,984 Q643L probably damaging Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Cyp2b23 T C 7: 26,681,695 Y79C probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Emc1 C T 4: 139,371,623 R806C probably damaging Het
Epg5 G A 18: 77,968,586 R816Q probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Fchsd1 A T 18: 37,966,642 probably null Het
Foxp1 T C 6: 98,945,660 T404A unknown Het
Fra10ac1 T C 19: 38,189,838 E299G probably damaging Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Gpam A C 19: 55,088,921 V146G probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Lrrc17 A T 5: 21,561,080 N187Y probably damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Nlrp3 T A 11: 59,543,003 probably null Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Sh3gl2 T A 4: 85,398,840 probably null Het
Slc24a4 A G 12: 102,218,960 M93V possibly damaging Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Ttk A G 9: 83,865,153 T682A probably benign Het
Virma C T 4: 11,549,682 R1807W probably damaging Het
Virma A G 4: 11,513,016 probably null Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in Macc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00915:Macc1 APN 12 119447014 missense probably benign 0.16
IGL01515:Macc1 APN 12 119450371 missense probably damaging 1.00
IGL01638:Macc1 APN 12 119446511 missense probably benign 0.00
IGL01653:Macc1 APN 12 119450353 missense probably damaging 1.00
IGL01982:Macc1 APN 12 119445634 missense probably benign 0.12
IGL02177:Macc1 APN 12 119465557 missense probably damaging 1.00
IGL02263:Macc1 APN 12 119446017 missense possibly damaging 0.87
IGL03199:Macc1 APN 12 119446421 missense probably benign 0.24
IGL03246:Macc1 APN 12 119446685 missense probably benign 0.00
IGL03265:Macc1 APN 12 119446976 missense probably benign 0.00
IGL03306:Macc1 APN 12 119446868 missense probably benign 0.00
IGL03307:Macc1 APN 12 119446420 missense probably benign
IGL03386:Macc1 APN 12 119445863 missense probably benign
PIT4366001:Macc1 UTSW 12 119446949 missense probably benign 0.01
PIT4431001:Macc1 UTSW 12 119446511 missense probably benign 0.00
R0033:Macc1 UTSW 12 119446341 missense probably benign 0.03
R0166:Macc1 UTSW 12 119447080 nonsense probably null
R0528:Macc1 UTSW 12 119447045 missense probably benign 0.09
R0688:Macc1 UTSW 12 119447003 missense probably damaging 0.96
R0725:Macc1 UTSW 12 119447516 nonsense probably null
R1356:Macc1 UTSW 12 119446555 missense probably benign 0.00
R1647:Macc1 UTSW 12 119446421 missense probably benign 0.24
R1648:Macc1 UTSW 12 119446421 missense probably benign 0.24
R1938:Macc1 UTSW 12 119445731 missense probably damaging 1.00
R2362:Macc1 UTSW 12 119447658 splice site probably benign
R2406:Macc1 UTSW 12 119465611 missense probably damaging 0.99
R3123:Macc1 UTSW 12 119447633 missense probably damaging 1.00
R3713:Macc1 UTSW 12 119446841 missense probably benign
R3915:Macc1 UTSW 12 119446816 missense probably benign 0.13
R5256:Macc1 UTSW 12 119446529 missense possibly damaging 0.87
R5329:Macc1 UTSW 12 119446477 missense probably damaging 1.00
R5555:Macc1 UTSW 12 119450375 missense probably benign 0.24
R5992:Macc1 UTSW 12 119447585 missense probably damaging 0.96
R6024:Macc1 UTSW 12 119450425 missense probably benign 0.01
R6064:Macc1 UTSW 12 119445665 missense probably benign 0.14
R6196:Macc1 UTSW 12 119446050 missense probably damaging 1.00
R6697:Macc1 UTSW 12 119447256 missense possibly damaging 0.73
R7046:Macc1 UTSW 12 119447038 missense probably benign 0.02
R7060:Macc1 UTSW 12 119447455 missense probably damaging 1.00
R7094:Macc1 UTSW 12 119450391 nonsense probably null
R7120:Macc1 UTSW 12 119445745 missense possibly damaging 0.87
R7496:Macc1 UTSW 12 119446999 missense possibly damaging 0.56
R7534:Macc1 UTSW 12 119447519 missense probably benign 0.45
R7591:Macc1 UTSW 12 119446658 missense probably damaging 0.99
R7823:Macc1 UTSW 12 119447065 missense probably damaging 0.98
R8121:Macc1 UTSW 12 119446589 missense probably damaging 0.97
R8157:Macc1 UTSW 12 119445993 missense probably benign 0.04
R8185:Macc1 UTSW 12 119447159 missense probably damaging 0.98
R8530:Macc1 UTSW 12 119445739 missense probably damaging 0.98
R8548:Macc1 UTSW 12 119450356 missense probably benign 0.40
R8713:Macc1 UTSW 12 119443526 critical splice donor site probably benign
R8772:Macc1 UTSW 12 119447485 missense probably damaging 1.00
R8825:Macc1 UTSW 12 119445852 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- ATGGCTTGGCTTAGTCAACG -3'
(R):5'- AGGCTGTACAAACACACCATTTTAG -3'

Sequencing Primer
(F):5'- AACGTCAGTTGGCTCGCTC -3'
(R):5'- AGTCATGACTTGGCTCAGAGGATC -3'
Posted On2019-11-12