Incidental Mutation 'R7715:C330027C09Rik'
ID594882
Institutional Source Beutler Lab
Gene Symbol C330027C09Rik
Ensembl Gene ENSMUSG00000033031
Gene NameRIKEN cDNA C330027C09 gene
SynonymsCip2a
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R7715 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location48994185-49019709 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49013984 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 643 (Q643L)
Ref Sequence ENSEMBL: ENSMUSP00000044714 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048374] [ENSMUST00000117994]
Predicted Effect probably damaging
Transcript: ENSMUST00000048374
AA Change: Q643L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044714
Gene: ENSMUSG00000033031
AA Change: Q643L

DomainStartEndE-ValueType
SCOP:d1jdha_ 47 309 3e-4 SMART
low complexity region 439 450 N/A INTRINSIC
coiled coil region 635 887 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117994
AA Change: Q643L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113075
Gene: ENSMUSG00000033031
AA Change: Q643L

DomainStartEndE-ValueType
SCOP:d1jdha_ 47 309 2e-4 SMART
low complexity region 439 450 N/A INTRINSIC
coiled coil region 635 887 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele display oligozoospermia, small epididymis and impaired spermatogonial progenitor cell maintenance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Cyp2b23 T C 7: 26,681,695 Y79C probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Emc1 C T 4: 139,371,623 R806C probably damaging Het
Epg5 G A 18: 77,968,586 R816Q probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Foxp1 T C 6: 98,945,660 T404A unknown Het
Fra10ac1 T C 19: 38,189,838 E299G probably damaging Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Gpam A C 19: 55,088,921 V146G probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Lrrc17 A T 5: 21,561,080 N187Y probably damaging Het
Macc1 C T 12: 119,446,256 A253V possibly damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Slc24a4 A G 12: 102,218,960 M93V possibly damaging Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Ttk A G 9: 83,865,153 T682A probably benign Het
Virma C T 4: 11,549,682 R1807W probably damaging Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in C330027C09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C330027C09Rik APN 16 49001815 missense probably damaging 1.00
IGL00788:C330027C09Rik APN 16 49009069 splice site probably benign
IGL01343:C330027C09Rik APN 16 49013188 missense probably damaging 1.00
IGL01348:C330027C09Rik APN 16 49013188 missense probably damaging 1.00
IGL01876:C330027C09Rik APN 16 49001678 missense probably damaging 1.00
IGL02255:C330027C09Rik APN 16 49010813 missense probably damaging 0.99
IGL02515:C330027C09Rik APN 16 49005733 missense possibly damaging 0.47
IGL03295:C330027C09Rik APN 16 48994341 missense probably damaging 1.00
R0020:C330027C09Rik UTSW 16 49001612 missense probably damaging 1.00
R0020:C330027C09Rik UTSW 16 49001612 missense probably damaging 1.00
R0031:C330027C09Rik UTSW 16 49017373 missense probably benign 0.14
R0612:C330027C09Rik UTSW 16 48999039 missense probably benign 0.04
R1187:C330027C09Rik UTSW 16 49000293 missense probably damaging 1.00
R1707:C330027C09Rik UTSW 16 49018404 missense probably damaging 1.00
R1711:C330027C09Rik UTSW 16 49017486 missense probably benign 0.31
R1715:C330027C09Rik UTSW 16 49005719 missense probably benign 0.18
R2000:C330027C09Rik UTSW 16 49014969 missense probably damaging 0.99
R2002:C330027C09Rik UTSW 16 49005851 splice site probably benign
R2360:C330027C09Rik UTSW 16 49017465 nonsense probably null
R4093:C330027C09Rik UTSW 16 49000976 splice site probably benign
R4292:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4293:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4295:C330027C09Rik UTSW 16 49013249 missense probably benign 0.00
R4726:C330027C09Rik UTSW 16 49014070 missense probably benign 0.02
R4925:C330027C09Rik UTSW 16 49016363 critical splice donor site probably null
R5735:C330027C09Rik UTSW 16 49017493 critical splice donor site probably null
R5893:C330027C09Rik UTSW 16 48997500 missense probably benign
R6146:C330027C09Rik UTSW 16 48994329 nonsense probably null
R6649:C330027C09Rik UTSW 16 49017466 missense probably damaging 1.00
R7235:C330027C09Rik UTSW 16 49001059 missense probably damaging 1.00
R7300:C330027C09Rik UTSW 16 49013854 missense probably damaging 1.00
R7325:C330027C09Rik UTSW 16 49005821 missense probably benign 0.32
R7365:C330027C09Rik UTSW 16 49001653 missense probably benign 0.35
R7414:C330027C09Rik UTSW 16 49001635 missense probably benign 0.21
R7780:C330027C09Rik UTSW 16 49001660 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGCTGAACCTTGCTCTGATAG -3'
(R):5'- CCTGCAACTAGTACTGTGCATGG -3'

Sequencing Primer
(F):5'- CTCTGTTAAAACCAGGTAAAGGATC -3'
(R):5'- CAACTAGTACTGTGCATGGTTTTC -3'
Posted On2019-11-12