Incidental Mutation 'R7715:Epg5'
ID594886
Institutional Source Beutler Lab
Gene Symbol Epg5
Ensembl Gene ENSMUSG00000039840
Gene Nameectopic P-granules autophagy protein 5 homolog (C. elegans)
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R7715 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location77938467-78035027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77968586 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 816 (R816Q)
Ref Sequence ENSEMBL: ENSMUSP00000038681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044622]
Predicted Effect probably damaging
Transcript: ENSMUST00000044622
AA Change: R816Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: R816Q

DomainStartEndE-ValueType
low complexity region 299 309 N/A INTRINSIC
low complexity region 395 406 N/A INTRINSIC
low complexity region 1074 1085 N/A INTRINSIC
low complexity region 1499 1516 N/A INTRINSIC
coiled coil region 1600 1626 N/A INTRINSIC
low complexity region 2132 2145 N/A INTRINSIC
low complexity region 2416 2427 N/A INTRINSIC
low complexity region 2454 2469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
C330027C09Rik A T 16: 49,013,984 Q643L probably damaging Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Cyp2b23 T C 7: 26,681,695 Y79C probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Emc1 C T 4: 139,371,623 R806C probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Foxp1 T C 6: 98,945,660 T404A unknown Het
Fra10ac1 T C 19: 38,189,838 E299G probably damaging Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Gpam A C 19: 55,088,921 V146G probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Lrrc17 A T 5: 21,561,080 N187Y probably damaging Het
Macc1 C T 12: 119,446,256 A253V possibly damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Slc24a4 A G 12: 102,218,960 M93V possibly damaging Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Ttk A G 9: 83,865,153 T682A probably benign Het
Virma C T 4: 11,549,682 R1807W probably damaging Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in Epg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01680:Epg5 APN 18 78012741 missense probably damaging 1.00
IGL01778:Epg5 APN 18 78019274 missense probably damaging 0.98
IGL01936:Epg5 APN 18 77985101 missense probably damaging 1.00
IGL02189:Epg5 APN 18 78012870 missense probably damaging 0.99
IGL02323:Epg5 APN 18 78012832 nonsense probably null
IGL02567:Epg5 APN 18 78033073 missense probably damaging 1.00
IGL02805:Epg5 APN 18 78030191 splice site probably benign
IGL03282:Epg5 APN 18 77986426 missense probably benign 0.25
stitch UTSW 18 77948299 nonsense probably null
R0011:Epg5 UTSW 18 77948483 missense probably benign
R0172:Epg5 UTSW 18 78027359 missense probably benign 0.00
R0335:Epg5 UTSW 18 77986472 missense probably benign 0.25
R0380:Epg5 UTSW 18 77960841 missense probably damaging 1.00
R0441:Epg5 UTSW 18 78023271 splice site probably benign
R0443:Epg5 UTSW 18 77955903 splice site probably benign
R0445:Epg5 UTSW 18 78014184 missense possibly damaging 0.87
R0448:Epg5 UTSW 18 78023365 missense probably damaging 1.00
R0892:Epg5 UTSW 18 77968628 missense possibly damaging 0.94
R1081:Epg5 UTSW 18 77959533 missense possibly damaging 0.92
R1183:Epg5 UTSW 18 77960711 missense probably damaging 1.00
R1374:Epg5 UTSW 18 77981326 missense probably benign
R1428:Epg5 UTSW 18 77962427 missense probably damaging 1.00
R1727:Epg5 UTSW 18 78015815 missense possibly damaging 0.94
R1780:Epg5 UTSW 18 78023990 missense probably damaging 0.99
R1801:Epg5 UTSW 18 77983490 missense possibly damaging 0.63
R1864:Epg5 UTSW 18 77975031 missense probably damaging 0.99
R1908:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1909:Epg5 UTSW 18 77959032 missense probably benign 0.26
R1916:Epg5 UTSW 18 77965021 missense probably benign 0.00
R1986:Epg5 UTSW 18 77982306 critical splice acceptor site probably null
R2048:Epg5 UTSW 18 78023987 missense probably damaging 0.98
R2080:Epg5 UTSW 18 77948745 missense probably benign 0.01
R2106:Epg5 UTSW 18 77991363 nonsense probably null
R2144:Epg5 UTSW 18 77954197 missense possibly damaging 0.78
R2151:Epg5 UTSW 18 78027302 missense probably benign
R2217:Epg5 UTSW 18 77949072 missense probably benign
R2424:Epg5 UTSW 18 77968613 missense probably benign 0.05
R2909:Epg5 UTSW 18 77983476 missense probably damaging 1.00
R3725:Epg5 UTSW 18 78017679 missense probably benign 0.00
R3899:Epg5 UTSW 18 77957510 missense probably damaging 1.00
R4019:Epg5 UTSW 18 78030450 missense probably damaging 0.98
R4260:Epg5 UTSW 18 77959121 missense possibly damaging 0.50
R4260:Epg5 UTSW 18 78015699 missense probably damaging 1.00
R4448:Epg5 UTSW 18 77962461 missense probably damaging 1.00
R4475:Epg5 UTSW 18 77948508 missense probably benign
R4612:Epg5 UTSW 18 77982414 missense possibly damaging 0.77
R4666:Epg5 UTSW 18 78012864 missense probably benign 0.45
R4767:Epg5 UTSW 18 78023283 missense possibly damaging 0.67
R4779:Epg5 UTSW 18 77991365 missense probably benign 0.01
R4791:Epg5 UTSW 18 77948996 nonsense probably null
R4797:Epg5 UTSW 18 78030399 missense probably benign 0.00
R4812:Epg5 UTSW 18 77979184 missense probably benign 0.01
R4899:Epg5 UTSW 18 77985057 missense probably damaging 1.00
R5000:Epg5 UTSW 18 77954161 missense probably benign
R5031:Epg5 UTSW 18 78028948 missense probably benign 0.00
R5050:Epg5 UTSW 18 77975941 missense possibly damaging 0.55
R5114:Epg5 UTSW 18 77995613 missense probably benign
R5144:Epg5 UTSW 18 78015680 missense probably damaging 1.00
R5209:Epg5 UTSW 18 77951282 missense probably damaging 1.00
R5213:Epg5 UTSW 18 78014834 missense probably benign 0.01
R5270:Epg5 UTSW 18 77983563 missense possibly damaging 0.79
R5324:Epg5 UTSW 18 77962445 missense possibly damaging 0.94
R5443:Epg5 UTSW 18 78027497 missense possibly damaging 0.55
R5503:Epg5 UTSW 18 77951207 missense possibly damaging 0.81
R5593:Epg5 UTSW 18 77957474 missense probably damaging 1.00
R5718:Epg5 UTSW 18 77986403 missense probably damaging 1.00
R5773:Epg5 UTSW 18 77960825 missense probably damaging 1.00
R5828:Epg5 UTSW 18 78020851 missense probably damaging 0.99
R5847:Epg5 UTSW 18 78030055 missense probably benign 0.06
R5858:Epg5 UTSW 18 77948299 nonsense probably null
R5914:Epg5 UTSW 18 77959632 critical splice donor site probably null
R6124:Epg5 UTSW 18 78030045 missense probably benign
R6228:Epg5 UTSW 18 77948462 missense possibly damaging 0.90
R6252:Epg5 UTSW 18 77985167 missense probably damaging 1.00
R6269:Epg5 UTSW 18 77948370 missense probably benign
R6312:Epg5 UTSW 18 77979211 missense possibly damaging 0.72
R6320:Epg5 UTSW 18 77962398 missense probably damaging 1.00
R6328:Epg5 UTSW 18 78028964 missense possibly damaging 0.88
R6430:Epg5 UTSW 18 77975885 missense probably damaging 1.00
R6458:Epg5 UTSW 18 77948254 missense probably benign 0.03
R6852:Epg5 UTSW 18 78012891 missense probably damaging 1.00
R6915:Epg5 UTSW 18 77979165 missense probably benign 0.00
R6930:Epg5 UTSW 18 78014163 missense probably damaging 0.99
R6932:Epg5 UTSW 18 77948609 missense probably benign 0.00
R7127:Epg5 UTSW 18 78028925 missense probably damaging 1.00
R7207:Epg5 UTSW 18 77948955 missense probably damaging 1.00
R7225:Epg5 UTSW 18 78012702 missense probably benign 0.45
R7358:Epg5 UTSW 18 77959037 missense possibly damaging 0.78
R7414:Epg5 UTSW 18 77983532 missense possibly damaging 0.65
R7437:Epg5 UTSW 18 78023278 missense probably benign 0.01
R7535:Epg5 UTSW 18 78032926 missense probably benign 0.18
R7586:Epg5 UTSW 18 78030060 missense probably benign
R7651:Epg5 UTSW 18 77981400 nonsense probably null
R7753:Epg5 UTSW 18 77948345 missense possibly damaging 0.92
X0023:Epg5 UTSW 18 77968657 missense probably damaging 0.99
X0060:Epg5 UTSW 18 77962485 missense possibly damaging 0.94
Z1088:Epg5 UTSW 18 77959139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGACAAGTTTCCGAGGCTC -3'
(R):5'- CCAGTGTCTCATGACTTCGG -3'

Sequencing Primer
(F):5'- CAAGTTTCCGAGGCTCAGTGTG -3'
(R):5'- AGACAGGGTTTCTCTGTAACAGCC -3'
Posted On2019-11-12