Incidental Mutation 'R7715:Fra10ac1'
ID594888
Institutional Source Beutler Lab
Gene Symbol Fra10ac1
Ensembl Gene ENSMUSG00000054237
Gene NameFRA10AC1 homolog (human)
Synonyms5730455O13Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.855) question?
Stock #R7715 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location38188481-38224138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38189838 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 299 (E299G)
Ref Sequence ENSEMBL: ENSMUSP00000070534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067167]
Predicted Effect probably damaging
Transcript: ENSMUST00000067167
AA Change: E299G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070534
Gene: ENSMUSG00000054237
AA Change: E299G

DomainStartEndE-ValueType
Pfam:Fra10Ac1 104 220 7e-56 PFAM
low complexity region 228 237 N/A INTRINSIC
low complexity region 242 255 N/A INTRINSIC
low complexity region 278 288 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a nuclear phosphoprotein of unknown function. This gene contains a tandem CGG repeat region within a CpG island that normally consists of 8-14 repeats but can expand to over 200 repeats. The repeat region is within the 5' UTR of some transcript variants, but is intronic to another variant. The expanded repeat allele is a fragile site and becomes hypermethylated, causing a reduction in gene expression. A disease phenotype has not been associated with expanded alleles. This gene is found within the rare FRA10A folate-sensitive fragile site. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
C330027C09Rik A T 16: 49,013,984 Q643L probably damaging Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Cyp2b23 T C 7: 26,681,695 Y79C probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Emc1 C T 4: 139,371,623 R806C probably damaging Het
Epg5 G A 18: 77,968,586 R816Q probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Foxp1 T C 6: 98,945,660 T404A unknown Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Gpam A C 19: 55,088,921 V146G probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Lrrc17 A T 5: 21,561,080 N187Y probably damaging Het
Macc1 C T 12: 119,446,256 A253V possibly damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Slc24a4 A G 12: 102,218,960 M93V possibly damaging Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Ttk A G 9: 83,865,153 T682A probably benign Het
Virma C T 4: 11,549,682 R1807W probably damaging Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in Fra10ac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00685:Fra10ac1 APN 19 38201564 missense probably damaging 0.99
IGL01784:Fra10ac1 APN 19 38219677 missense probably benign 0.32
IGL03396:Fra10ac1 APN 19 38201546 critical splice donor site probably null
R4349:Fra10ac1 UTSW 19 38199605 missense probably benign 0.00
R5090:Fra10ac1 UTSW 19 38214425 missense probably damaging 1.00
R5234:Fra10ac1 UTSW 19 38215846 missense probably damaging 1.00
R5259:Fra10ac1 UTSW 19 38199662 missense probably benign 0.00
R5445:Fra10ac1 UTSW 19 38219462 missense possibly damaging 0.82
R5768:Fra10ac1 UTSW 19 38207286 missense probably benign 0.02
R6756:Fra10ac1 UTSW 19 38215865 missense probably damaging 1.00
R6831:Fra10ac1 UTSW 19 38207289 missense probably benign 0.38
R7011:Fra10ac1 UTSW 19 38188794 missense probably benign 0.11
R7054:Fra10ac1 UTSW 19 38224119 start gained probably benign
R7530:Fra10ac1 UTSW 19 38215905 nonsense probably null
R7561:Fra10ac1 UTSW 19 38221876 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTGGCTGCTTGCATCCC -3'
(R):5'- AGCTGCTATTTTAGTGTAACATGGG -3'

Sequencing Primer
(F):5'- GGCTGCTTGCATCCCCAAAC -3'
(R):5'- ACTTGCATTCACTTTTTGATGAGGC -3'
Posted On2019-11-12