Incidental Mutation 'R7715:Gpam'
ID594889
Institutional Source Beutler Lab
Gene Symbol Gpam
Ensembl Gene ENSMUSG00000024978
Gene Nameglycerol-3-phosphate acyltransferase, mitochondrial
SynonymsGPAT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.234) question?
Stock #R7715 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location55069734-55099451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 55088921 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 146 (V146G)
Ref Sequence ENSEMBL: ENSMUSP00000057635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061856]
Predicted Effect probably benign
Transcript: ENSMUST00000061856
AA Change: V146G

PolyPhen 2 Score 0.187 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000057635
Gene: ENSMUSG00000024978
AA Change: V146G

DomainStartEndE-ValueType
Blast:PlsC 5 34 3e-8 BLAST
PlsC 224 357 2.46e-23 SMART
Blast:PlsC 499 551 8e-27 BLAST
low complexity region 687 699 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme which prefers saturated fatty acids as its substrate for the synthesis of glycerolipids. This metabolic pathway's first step is catalyzed by the encoded enzyme. Two forms for this enzyme exist, one in the mitochondria and one in the endoplasmic reticulum. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutant mice weighed less than controls and showed reduced triacylglycerol levels in the liver and plasma. The glycerolipid fatty acid composition is also disrupted in mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019A02Rik A G 1: 53,182,500 F57L probably benign Het
Agl C T 3: 116,758,256 R563Q Het
Ahctf1 A G 1: 179,770,848 M919T probably benign Het
Ano4 A T 10: 88,995,311 N483K probably damaging Het
Armt1 A G 10: 4,450,751 K166R probably benign Het
Asgr2 T C 11: 70,096,895 V73A probably benign Het
Atp6v0a2 A C 5: 124,714,198 T564P probably damaging Het
B3gntl1 T C 11: 121,639,796 T150A possibly damaging Het
Bach1 A G 16: 87,719,971 I467V possibly damaging Het
Bicd1 A G 6: 149,512,973 K395E probably benign Het
C330027C09Rik A T 16: 49,013,984 Q643L probably damaging Het
Cadps G A 14: 12,457,762 P1040S probably benign Het
Calcoco2 TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC TCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,100,036 probably null Het
Canx A G 11: 50,310,804 S80P probably benign Het
Ccdc149 T A 5: 52,404,191 probably null Het
Cd34 A T 1: 194,949,316 N87Y probably damaging Het
Cdh11 T A 8: 102,664,714 I297F possibly damaging Het
Col14a1 A G 15: 55,487,983 I1569V unknown Het
Cxcr4 C T 1: 128,589,742 V61M probably damaging Het
Cyp20a1 G A 1: 60,372,605 V271M probably benign Het
Cyp2b23 T C 7: 26,681,695 Y79C probably benign Het
Daam1 A G 12: 71,988,901 K957E probably benign Het
Dip2c A G 13: 9,614,391 K947E probably damaging Het
Efcab12 T C 6: 115,823,543 K173R possibly damaging Het
Emc1 C T 4: 139,371,623 R806C probably damaging Het
Epg5 G A 18: 77,968,586 R816Q probably damaging Het
Faf1 G T 4: 109,710,814 D24Y probably damaging Het
Fchsd1 A T 18: 37,966,642 probably null Het
Foxp1 T C 6: 98,945,660 T404A unknown Het
Fra10ac1 T C 19: 38,189,838 E299G probably damaging Het
Gon4l A G 3: 88,908,006 T1959A probably benign Het
Hephl1 T A 9: 15,060,785 D953V probably benign Het
Kcnc2 G T 10: 112,271,940 E79* probably null Het
Kcnj12 T A 11: 61,066,952 probably null Het
Llgl2 A T 11: 115,849,728 T417S probably benign Het
Lrrc17 A T 5: 21,561,080 N187Y probably damaging Het
Macc1 C T 12: 119,446,256 A253V possibly damaging Het
Mark1 A G 1: 184,907,234 S529P probably damaging Het
Mfsd6l T C 11: 68,557,550 L409P probably damaging Het
Nek1 A G 8: 61,006,760 E34G probably damaging Het
Nlrp3 T A 11: 59,543,003 probably null Het
Obsl1 A T 1: 75,502,036 V686D probably damaging Het
Olfr1537 A T 9: 39,237,878 L182H probably damaging Het
Olfr167 C T 16: 19,514,730 R302K probably benign Het
Olfr545 T A 7: 102,494,461 M105L possibly damaging Het
Olfr871 G A 9: 20,212,435 G29R probably damaging Het
Olfr871 G A 9: 20,212,436 G29E probably benign Het
Olfr893 T A 9: 38,209,479 M140K probably benign Het
Ostm1 G A 10: 42,683,187 G148R probably benign Het
Oxsr1 A G 9: 119,242,756 S470P probably damaging Het
Pacs1 C T 19: 5,141,681 M709I probably benign Het
Pan2 A G 10: 128,317,723 M963V probably benign Het
Pds5a A G 5: 65,638,561 L662P possibly damaging Het
Rsf1 GGCGGCGGC GGCGGCGGCCGCGGCGGC 7: 97,579,912 probably benign Het
Sh2b2 T C 5: 136,219,035 N554S probably benign Het
Sh3gl2 T A 4: 85,398,840 probably null Het
Slc24a4 A G 12: 102,218,960 M93V possibly damaging Het
Sohlh1 A G 2: 25,844,628 S218P possibly damaging Het
Spast T A 17: 74,368,926 N321K probably benign Het
Srcap T G 7: 127,549,288 I1936S probably damaging Het
Themis G A 10: 28,863,309 V592I probably benign Het
Tnfrsf1a C T 6: 125,361,414 T296I possibly damaging Het
Ttk A G 9: 83,865,153 T682A probably benign Het
Virma C T 4: 11,549,682 R1807W probably damaging Het
Virma A G 4: 11,513,016 probably null Het
Vmn2r101 T A 17: 19,611,915 D724E probably damaging Het
Vmn2r11 A G 5: 109,047,441 V673A probably damaging Het
Wbp4 C T 14: 79,466,294 S271N probably benign Het
Wdr66 A G 5: 123,262,134 N439D probably damaging Het
Other mutations in Gpam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gpam APN 19 55078332 missense possibly damaging 0.71
IGL01349:Gpam APN 19 55096119 critical splice donor site probably null
IGL01515:Gpam APN 19 55087451 missense probably damaging 1.00
IGL01650:Gpam APN 19 55081700 missense probably benign 0.02
IGL01768:Gpam APN 19 55087520 missense probably benign 0.00
IGL01809:Gpam APN 19 55075625 nonsense probably null
IGL01878:Gpam APN 19 55083374 missense probably benign 0.22
IGL02451:Gpam APN 19 55088203 missense probably damaging 1.00
IGL03293:Gpam APN 19 55071016 missense probably benign
IGL03391:Gpam APN 19 55081696 missense probably damaging 1.00
R0492:Gpam UTSW 19 55096179 missense possibly damaging 0.72
R0703:Gpam UTSW 19 55072756 missense probably benign 0.00
R1083:Gpam UTSW 19 55088211 splice site probably benign
R1432:Gpam UTSW 19 55079261 missense probably damaging 0.99
R1457:Gpam UTSW 19 55088176 missense probably damaging 1.00
R1556:Gpam UTSW 19 55076331 missense possibly damaging 0.94
R1733:Gpam UTSW 19 55081469 missense probably damaging 0.99
R1744:Gpam UTSW 19 55074591 missense probably damaging 1.00
R1776:Gpam UTSW 19 55078575 missense possibly damaging 0.88
R2267:Gpam UTSW 19 55072710 critical splice donor site probably null
R2697:Gpam UTSW 19 55083209 missense probably damaging 1.00
R3836:Gpam UTSW 19 55080458 missense probably benign
R3837:Gpam UTSW 19 55080458 missense probably benign
R3838:Gpam UTSW 19 55080458 missense probably benign
R3839:Gpam UTSW 19 55080458 missense probably benign
R4670:Gpam UTSW 19 55096119 critical splice donor site probably null
R4717:Gpam UTSW 19 55075614 missense probably benign 0.00
R4819:Gpam UTSW 19 55078341 missense probably benign 0.03
R5104:Gpam UTSW 19 55093986 missense probably benign 0.44
R5146:Gpam UTSW 19 55093946 missense probably damaging 1.00
R5183:Gpam UTSW 19 55083227 missense probably damaging 1.00
R5326:Gpam UTSW 19 55091165 missense probably benign 0.05
R5347:Gpam UTSW 19 55088837 missense probably damaging 1.00
R5621:Gpam UTSW 19 55079260 missense probably damaging 1.00
R5644:Gpam UTSW 19 55088899 missense probably benign 0.00
R6244:Gpam UTSW 19 55070985 missense probably damaging 1.00
R6260:Gpam UTSW 19 55083406 missense probably benign 0.40
R6965:Gpam UTSW 19 55074609 missense probably damaging 1.00
R7125:Gpam UTSW 19 55076335 missense probably benign
R7567:Gpam UTSW 19 55081630 missense possibly damaging 0.86
R7719:Gpam UTSW 19 55081670 missense probably damaging 1.00
R7863:Gpam UTSW 19 55070956 missense probably damaging 1.00
R8187:Gpam UTSW 19 55077837 missense probably benign
R8434:Gpam UTSW 19 55081631 missense possibly damaging 0.93
R8483:Gpam UTSW 19 55088942 missense probably damaging 0.99
R8510:Gpam UTSW 19 55080382 critical splice donor site probably null
R8537:Gpam UTSW 19 55096239 missense probably benign 0.02
R8841:Gpam UTSW 19 55078518 missense probably damaging 1.00
R8915:Gpam UTSW 19 55088880 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATCTACTTGAAGGAAACAGGCTGG -3'
(R):5'- TGGCTGATGGTCCCAACTTG -3'

Sequencing Primer
(F):5'- AAACAGGCTGGCTCGGG -3'
(R):5'- TCTCTCTGGCTGCTATACTATAAATG -3'
Posted On2019-11-12