Incidental Mutation 'R7716:Inpp5d'
ID594895
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Nameinositol polyphosphate-5-phosphatase D
Synonymss-SHIP, SHIP, Src homology 2 domain-containing inositol-5-phosphatase, SHIP1, SHIP-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R7716 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location87620312-87720507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87665399 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 74 (V74I)
Ref Sequence ENSEMBL: ENSMUSP00000127941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000163576] [ENSMUST00000168783] [ENSMUST00000169754]
Predicted Effect probably damaging
Transcript: ENSMUST00000042275
AA Change: V74I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: V74I

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072999
AA Change: V74I

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: V74I

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163576
Predicted Effect
SMART Domains Protein: ENSMUSP00000128700
Gene: ENSMUSG00000026288
AA Change: V43I

DomainStartEndE-ValueType
SCOP:d1d4ta_ 17 75 1e-12 SMART
Blast:SH2 19 65 2e-28 BLAST
PDB:2YSX|A 19 76 1e-36 PDB
low complexity region 77 88 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168783
AA Change: V74I

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: V74I

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169754
AA Change: V74I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: V74I

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,869,829 C41Y possibly damaging Het
3110062M04Rik T C 6: 34,875,581 N60D possibly damaging Het
Abcg1 A G 17: 31,109,519 I421V probably benign Het
Ank2 G T 3: 126,943,166 T3023K unknown Het
Asb5 T A 8: 54,584,986 H181Q probably benign Het
Asnsd1 C T 1: 53,347,743 V242I probably benign Het
Atp2a1 C A 7: 126,462,187 G46V possibly damaging Het
Birc6 A G 17: 74,562,061 S335G probably damaging Het
Bmp1 A T 14: 70,477,922 Y924* probably null Het
Ccdc3 T A 2: 5,138,302 F123L probably benign Het
Col6a6 C A 9: 105,783,903 V336L possibly damaging Het
Cpe T C 8: 64,611,397 Y256C probably damaging Het
Creb1 T A 1: 64,566,261 D62E possibly damaging Het
Cyp4a32 T A 4: 115,601,086 Y38N probably damaging Het
Dnajc1 A G 2: 18,219,873 S390P probably benign Het
E430018J23Rik T A 7: 127,392,087 M243L probably benign Het
Edrf1 G A 7: 133,643,726 E198K probably damaging Het
Ehmt1 A G 2: 24,884,499 S98P probably damaging Het
Emsy G A 7: 98,599,766 A812V unknown Het
Eppk1 A T 15: 76,107,503 L1726* probably null Het
Flnb G T 14: 7,917,274 K1584N possibly damaging Het
Gclc C T 9: 77,754,927 R40W probably damaging Het
Gm5065 T C 7: 5,359,820 I150T possibly damaging Het
Gnpat A G 8: 124,876,934 R194G probably benign Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Il17re T C 6: 113,462,969 probably null Het
Iqcb1 T C 16: 36,867,607 S443P probably benign Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Klhdc4 T A 8: 121,829,420 M21L unknown Het
Lrguk C T 6: 34,095,539 A588V probably damaging Het
March5 T C 19: 37,220,423 Y164H probably benign Het
Mbip T A 12: 56,345,688 H38L probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Myh8 A T 11: 67,298,652 Q1218L possibly damaging Het
Ndc80 A T 17: 71,523,594 I56K probably benign Het
Ndufs1 T C 1: 63,152,857 D437G possibly damaging Het
Nlrc4 A G 17: 74,446,656 L244P probably damaging Het
Olfr304 A T 7: 86,386,054 M202K probably benign Het
Olfr745 A G 14: 50,642,358 T20A probably benign Het
Pdc A C 1: 150,330,783 D40A probably benign Het
Pdzd2 T C 15: 12,373,374 Y2225C possibly damaging Het
Plce1 G T 19: 38,716,851 G900V probably benign Het
Plpp1 A T 13: 112,856,789 H86L probably benign Het
Plpp1 T G 13: 112,859,652 F168C probably damaging Het
Pms1 G A 1: 53,207,608 P312S probably damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Pygo1 A G 9: 72,942,926 D19G probably damaging Het
Sdr42e1 T A 8: 117,673,647 probably benign Het
Serpinb8 C T 1: 107,604,708 R177* probably null Het
Serpini1 A C 3: 75,616,714 S210R probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Smco3 T A 6: 136,831,249 Y209F probably damaging Het
Smtn C G 11: 3,524,708 S216T probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Sri T A 5: 8,056,641 probably null Het
Strn G A 17: 78,655,775 P716L probably damaging Het
Tmem167b T C 3: 108,558,897 Y69C probably damaging Het
Trpc7 A T 13: 56,789,760 F628I probably damaging Het
Trrap T A 5: 144,777,146 I65N possibly damaging Het
Tspan14 C A 14: 40,911,133 G201C probably damaging Het
Tti1 T A 2: 158,000,698 I804F probably benign Het
Unc5b C T 10: 60,777,438 G340R probably damaging Het
Usp13 C A 3: 32,837,856 Y61* probably null Het
Vmn1r230 T C 17: 20,846,882 M111T possibly damaging Het
Vmn2r26 T A 6: 124,061,745 Y760N probably damaging Het
Vmn2r87 A G 10: 130,472,149 V740A probably benign Het
Zbtb14 A G 17: 69,387,420 I38V probably benign Het
Zfp623 T C 15: 75,948,422 I409T probably damaging Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87683815 missense probably benign 0.00
IGL00329:Inpp5d APN 1 87668003 missense probably benign 0.00
IGL00897:Inpp5d APN 1 87712114 missense probably benign 0.14
IGL01314:Inpp5d APN 1 87683750 nonsense probably null
IGL02145:Inpp5d APN 1 87715055 missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87708132 missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87695366 missense probably null 0.92
IGL02680:Inpp5d APN 1 87701483 missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87711141 missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87703197 missense probably damaging 1.00
americas UTSW 1 87715142 missense probably damaging 1.00
auburn UTSW 1 87681680 splice site probably null
naranjo UTSW 1 87708211 critical splice donor site probably null
New_black UTSW 1 87709675 missense probably damaging 1.00
Orange UTSW 1 87697546 critical splice donor site probably null
pantone UTSW 1 87699675 missense probably damaging 1.00
sailing UTSW 1 87705964 missense probably damaging 1.00
styx UTSW 1 87669784 critical splice donor site probably benign
ulster UTSW 1 87701476 nonsense probably null
R0010:Inpp5d UTSW 1 87697546 critical splice donor site probably null
R0037:Inpp5d UTSW 1 87708129 missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87715138 missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87698150 missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87705920 splice site probably benign
R0733:Inpp5d UTSW 1 87668077 splice site probably benign
R1464:Inpp5d UTSW 1 87698105 splice site probably benign
R1576:Inpp5d UTSW 1 87669685 missense probably benign 0.16
R1576:Inpp5d UTSW 1 87681558 missense probably damaging 0.96
R1592:Inpp5d UTSW 1 87665532 missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87699081 missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87667889 missense probably benign 0.30
R1972:Inpp5d UTSW 1 87676314 missense probably benign 0.00
R2024:Inpp5d UTSW 1 87695350 nonsense probably null
R2405:Inpp5d UTSW 1 87699729 missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87668057 missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87701408 splice site probably benign
R4652:Inpp5d UTSW 1 87665451 missense probably benign 0.03
R4676:Inpp5d UTSW 1 87715142 missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87697523 missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87705964 missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87676342 missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87709675 missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87718066 missense probably benign 0.02
R5875:Inpp5d UTSW 1 87717974 missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87620397 unclassified probably null
R6371:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87699675 missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87676250 start gained probably benign
R6572:Inpp5d UTSW 1 87695396 missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87701476 nonsense probably null
R6853:Inpp5d UTSW 1 87681680 splice site probably null
R6883:Inpp5d UTSW 1 87699690 missense probably damaging 0.98
R7082:Inpp5d UTSW 1 87695380 missense probably damaging 0.99
R7215:Inpp5d UTSW 1 87701218 missense probably benign 0.30
R7418:Inpp5d UTSW 1 87708211 critical splice donor site probably null
R7471:Inpp5d UTSW 1 87695400 missense probably damaging 1.00
R7593:Inpp5d UTSW 1 87717778 missense possibly damaging 0.82
R7781:Inpp5d UTSW 1 87699672 missense probably damaging 1.00
R7808:Inpp5d UTSW 1 87683845 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCTTGGCCCTTTGAGATTATAG -3'
(R):5'- ACCACAGAGTCCTTTTGTCACC -3'

Sequencing Primer
(F):5'- CATTTTTAACAGATGGAGAGAAA -3'
(R):5'- GTCACCTCCCCACACTTG -3'
Posted On2019-11-12