Incidental Mutation 'R7716:Lrguk'
ID 594911
Institutional Source Beutler Lab
Gene Symbol Lrguk
Ensembl Gene ENSMUSG00000056215
Gene Name leucine-rich repeats and guanylate kinase domain containing
Synonyms 4921528H16Rik
MMRRC Submission 045774-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7716 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 34006379-34110969 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34072474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 588 (A588V)
Ref Sequence ENSEMBL: ENSMUSP00000065146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070189] [ENSMUST00000228187]
AlphaFold Q9D5S7
Predicted Effect probably damaging
Transcript: ENSMUST00000070189
AA Change: A588V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065146
Gene: ENSMUSG00000056215
AA Change: A588V

DomainStartEndE-ValueType
coiled coil region 75 113 N/A INTRINSIC
LRR 148 170 2.69e2 SMART
LRR 236 258 1.86e2 SMART
LRR 279 301 1.99e0 SMART
LRR 326 349 1.58e2 SMART
GuKc 414 600 6.84e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000228187
AA Change: A588V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,777,162 (GRCm39) C41Y possibly damaging Het
Abcg1 A G 17: 31,328,493 (GRCm39) I421V probably benign Het
Ank2 G T 3: 126,736,815 (GRCm39) T3023K unknown Het
Asb5 T A 8: 55,038,021 (GRCm39) H181Q probably benign Het
Asnsd1 C T 1: 53,386,902 (GRCm39) V242I probably benign Het
Atp2a1 C A 7: 126,061,359 (GRCm39) G46V possibly damaging Het
Birc6 A G 17: 74,869,056 (GRCm39) S335G probably damaging Het
Bmp1 A T 14: 70,715,362 (GRCm39) Y924* probably null Het
Ccdc3 T A 2: 5,143,113 (GRCm39) F123L probably benign Het
Col6a6 C A 9: 105,661,102 (GRCm39) V336L possibly damaging Het
Cpe T C 8: 65,064,431 (GRCm39) Y256C probably damaging Het
Creb1 T A 1: 64,605,420 (GRCm39) D62E possibly damaging Het
Cyp4a32 T A 4: 115,458,283 (GRCm39) Y38N probably damaging Het
Cyren T C 6: 34,852,516 (GRCm39) N60D possibly damaging Het
Dnajc1 A G 2: 18,224,684 (GRCm39) S390P probably benign Het
Edrf1 G A 7: 133,245,455 (GRCm39) E198K probably damaging Het
Ehmt1 A G 2: 24,774,511 (GRCm39) S98P probably damaging Het
Emsy G A 7: 98,248,973 (GRCm39) A812V unknown Het
Eppk1 A T 15: 75,991,703 (GRCm39) L1726* probably null Het
Flnb G T 14: 7,917,274 (GRCm38) K1584N possibly damaging Het
Gclc C T 9: 77,662,209 (GRCm39) R40W probably damaging Het
Gnpat A G 8: 125,603,673 (GRCm39) R194G probably benign Het
Gpd1 G A 15: 99,619,967 (GRCm39) S255N probably damaging Het
Il17re T C 6: 113,439,930 (GRCm39) probably null Het
Inpp5d G A 1: 87,593,121 (GRCm39) V74I probably damaging Het
Iqcb1 T C 16: 36,687,969 (GRCm39) S443P probably benign Het
Irak2 AC ACC 6: 113,667,859 (GRCm39) probably null Het
Kansl1l A G 1: 66,840,292 (GRCm39) V336A probably damaging Het
Klhdc4 T A 8: 122,556,159 (GRCm39) M21L unknown Het
Lgalsl2 T C 7: 5,362,819 (GRCm39) I150T possibly damaging Het
Marchf5 T C 19: 37,197,822 (GRCm39) Y164H probably benign Het
Mbip T A 12: 56,392,473 (GRCm39) H38L probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,427,071 (GRCm39) probably benign Het
Myh8 A T 11: 67,189,478 (GRCm39) Q1218L possibly damaging Het
Ndc80 A T 17: 71,830,589 (GRCm39) I56K probably benign Het
Ndufs1 T C 1: 63,192,016 (GRCm39) D437G possibly damaging Het
Nlrc4 A G 17: 74,753,651 (GRCm39) L244P probably damaging Het
Or11h6 A G 14: 50,879,815 (GRCm39) T20A probably benign Het
Or14a258 A T 7: 86,035,262 (GRCm39) M202K probably benign Het
Pdc A C 1: 150,206,534 (GRCm39) D40A probably benign Het
Pdzd2 T C 15: 12,373,460 (GRCm39) Y2225C possibly damaging Het
Plce1 G T 19: 38,705,295 (GRCm39) G900V probably benign Het
Plpp1 A T 13: 112,993,323 (GRCm39) H86L probably benign Het
Plpp1 T G 13: 112,996,186 (GRCm39) F168C probably damaging Het
Pms1 G A 1: 53,246,767 (GRCm39) P312S probably damaging Het
Prf1 G A 10: 61,135,934 (GRCm39) R70H possibly damaging Het
Pygo1 A G 9: 72,850,208 (GRCm39) D19G probably damaging Het
Sdr42e1 T A 8: 118,400,386 (GRCm39) probably benign Het
Serpinb8 C T 1: 107,532,438 (GRCm39) R177* probably null Het
Serpini1 A C 3: 75,524,021 (GRCm39) S210R probably damaging Het
Slc29a4 C T 5: 142,704,261 (GRCm39) P305L probably benign Het
Smco3 T A 6: 136,808,247 (GRCm39) Y209F probably damaging Het
Smtn C G 11: 3,474,708 (GRCm39) S216T probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Sri T A 5: 8,106,641 (GRCm39) probably null Het
Strn G A 17: 78,963,204 (GRCm39) P716L probably damaging Het
Tmem167b T C 3: 108,466,213 (GRCm39) Y69C probably damaging Het
Trpc7 A T 13: 56,937,573 (GRCm39) F628I probably damaging Het
Trrap T A 5: 144,713,956 (GRCm39) I65N possibly damaging Het
Tspan14 C A 14: 40,633,090 (GRCm39) G201C probably damaging Het
Tti1 T A 2: 157,842,618 (GRCm39) I804F probably benign Het
Unc5b C T 10: 60,613,217 (GRCm39) G340R probably damaging Het
Usp13 C A 3: 32,892,005 (GRCm39) Y61* probably null Het
Vmn1r230 T C 17: 21,067,144 (GRCm39) M111T possibly damaging Het
Vmn2r26 T A 6: 124,038,704 (GRCm39) Y760N probably damaging Het
Vmn2r87 A G 10: 130,308,018 (GRCm39) V740A probably benign Het
Zbtb14 A G 17: 69,694,415 (GRCm39) I38V probably benign Het
Zfp623 T C 15: 75,820,271 (GRCm39) I409T probably damaging Het
Zfp764l1 T A 7: 126,991,259 (GRCm39) M243L probably benign Het
Other mutations in Lrguk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Lrguk APN 6 34,020,364 (GRCm39) missense probably damaging 1.00
IGL00566:Lrguk APN 6 34,033,109 (GRCm39) missense probably damaging 1.00
IGL01720:Lrguk APN 6 34,020,412 (GRCm39) missense probably damaging 1.00
IGL02325:Lrguk APN 6 34,106,114 (GRCm39) missense probably benign 0.31
IGL02484:Lrguk APN 6 34,069,726 (GRCm39) missense probably damaging 1.00
IGL02493:Lrguk APN 6 34,106,127 (GRCm39) missense probably benign 0.03
IGL02636:Lrguk APN 6 34,067,123 (GRCm39) missense probably damaging 1.00
IGL03278:Lrguk APN 6 34,093,381 (GRCm39) missense possibly damaging 0.80
R0031:Lrguk UTSW 6 34,020,431 (GRCm39) missense probably damaging 0.99
R1069:Lrguk UTSW 6 34,025,818 (GRCm39) missense possibly damaging 0.63
R1487:Lrguk UTSW 6 34,039,295 (GRCm39) missense probably benign 0.01
R1568:Lrguk UTSW 6 34,063,373 (GRCm39) missense probably damaging 1.00
R1604:Lrguk UTSW 6 34,049,305 (GRCm39) missense possibly damaging 0.67
R1847:Lrguk UTSW 6 34,110,322 (GRCm39) missense possibly damaging 0.52
R2045:Lrguk UTSW 6 34,048,003 (GRCm39) missense probably damaging 1.00
R2107:Lrguk UTSW 6 34,039,296 (GRCm39) missense probably benign 0.15
R2125:Lrguk UTSW 6 34,069,837 (GRCm39) missense probably benign 0.05
R2136:Lrguk UTSW 6 34,020,454 (GRCm39) missense probably benign 0.00
R2997:Lrguk UTSW 6 34,050,697 (GRCm39) missense probably damaging 0.98
R3847:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R3849:Lrguk UTSW 6 34,050,703 (GRCm39) missense probably damaging 1.00
R4626:Lrguk UTSW 6 34,106,158 (GRCm39) missense probably benign 0.00
R4718:Lrguk UTSW 6 34,006,431 (GRCm39) missense probably benign 0.02
R4778:Lrguk UTSW 6 34,033,015 (GRCm39) missense probably damaging 1.00
R4841:Lrguk UTSW 6 34,069,802 (GRCm39) missense probably damaging 0.98
R5324:Lrguk UTSW 6 34,050,732 (GRCm39) missense possibly damaging 0.87
R5450:Lrguk UTSW 6 34,047,996 (GRCm39) missense probably damaging 1.00
R5741:Lrguk UTSW 6 34,025,802 (GRCm39) missense probably damaging 0.99
R5939:Lrguk UTSW 6 34,055,688 (GRCm39) missense probably damaging 1.00
R5997:Lrguk UTSW 6 34,106,078 (GRCm39) missense probably damaging 0.99
R6786:Lrguk UTSW 6 34,072,522 (GRCm39) missense probably benign 0.11
R6802:Lrguk UTSW 6 34,039,392 (GRCm39) missense probably damaging 1.00
R7081:Lrguk UTSW 6 34,079,074 (GRCm39) missense probably benign 0.01
R7303:Lrguk UTSW 6 34,006,411 (GRCm39) missense probably benign 0.00
R7316:Lrguk UTSW 6 34,080,191 (GRCm39) missense unknown
R7473:Lrguk UTSW 6 34,006,630 (GRCm39) missense probably benign 0.01
R7543:Lrguk UTSW 6 34,025,870 (GRCm39) nonsense probably null
R7613:Lrguk UTSW 6 34,078,683 (GRCm39) missense possibly damaging 0.68
R7900:Lrguk UTSW 6 34,106,129 (GRCm39) missense probably benign 0.01
R8012:Lrguk UTSW 6 34,033,038 (GRCm39) missense probably benign 0.00
R8251:Lrguk UTSW 6 34,093,374 (GRCm39) missense probably benign 0.00
R8324:Lrguk UTSW 6 34,079,506 (GRCm39) missense probably benign 0.03
R8551:Lrguk UTSW 6 34,093,446 (GRCm39) missense probably damaging 0.96
R8828:Lrguk UTSW 6 34,080,572 (GRCm39) missense unknown
R8879:Lrguk UTSW 6 34,006,618 (GRCm39) missense probably benign 0.00
X0057:Lrguk UTSW 6 34,055,682 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TCAGCCTGTTAGGTCAGCAT -3'
(R):5'- GAGCCAGCATTAGCCCAACTAA -3'

Sequencing Primer
(F):5'- CTATGATCTGAGTGAACCACCTGG -3'
(R):5'- TTAGCCCAACTAATGAGTAACCAAG -3'
Posted On 2019-11-12