Incidental Mutation 'R7716:Vmn2r26'
ID 594915
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock # R7716 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124024758-124062035 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124061745 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 760 (Y760N)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: Y760N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: Y760N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,869,829 C41Y possibly damaging Het
3110062M04Rik T C 6: 34,875,581 N60D possibly damaging Het
Abcg1 A G 17: 31,109,519 I421V probably benign Het
Ank2 G T 3: 126,943,166 T3023K unknown Het
Asb5 T A 8: 54,584,986 H181Q probably benign Het
Asnsd1 C T 1: 53,347,743 V242I probably benign Het
Atp2a1 C A 7: 126,462,187 G46V possibly damaging Het
Birc6 A G 17: 74,562,061 S335G probably damaging Het
Bmp1 A T 14: 70,477,922 Y924* probably null Het
Ccdc3 T A 2: 5,138,302 F123L probably benign Het
Col6a6 C A 9: 105,783,903 V336L possibly damaging Het
Cpe T C 8: 64,611,397 Y256C probably damaging Het
Creb1 T A 1: 64,566,261 D62E possibly damaging Het
Cyp4a32 T A 4: 115,601,086 Y38N probably damaging Het
Dnajc1 A G 2: 18,219,873 S390P probably benign Het
E430018J23Rik T A 7: 127,392,087 M243L probably benign Het
Edrf1 G A 7: 133,643,726 E198K probably damaging Het
Ehmt1 A G 2: 24,884,499 S98P probably damaging Het
Emsy G A 7: 98,599,766 A812V unknown Het
Eppk1 A T 15: 76,107,503 L1726* probably null Het
Flnb G T 14: 7,917,274 K1584N possibly damaging Het
Gclc C T 9: 77,754,927 R40W probably damaging Het
Gm5065 T C 7: 5,359,820 I150T possibly damaging Het
Gnpat A G 8: 124,876,934 R194G probably benign Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Il17re T C 6: 113,462,969 probably null Het
Inpp5d G A 1: 87,665,399 V74I probably damaging Het
Iqcb1 T C 16: 36,867,607 S443P probably benign Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Klhdc4 T A 8: 121,829,420 M21L unknown Het
Lrguk C T 6: 34,095,539 A588V probably damaging Het
March5 T C 19: 37,220,423 Y164H probably benign Het
Mbip T A 12: 56,345,688 H38L probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Myh8 A T 11: 67,298,652 Q1218L possibly damaging Het
Ndc80 A T 17: 71,523,594 I56K probably benign Het
Ndufs1 T C 1: 63,152,857 D437G possibly damaging Het
Nlrc4 A G 17: 74,446,656 L244P probably damaging Het
Olfr304 A T 7: 86,386,054 M202K probably benign Het
Olfr745 A G 14: 50,642,358 T20A probably benign Het
Pdc A C 1: 150,330,783 D40A probably benign Het
Pdzd2 T C 15: 12,373,374 Y2225C possibly damaging Het
Plce1 G T 19: 38,716,851 G900V probably benign Het
Plpp1 A T 13: 112,856,789 H86L probably benign Het
Plpp1 T G 13: 112,859,652 F168C probably damaging Het
Pms1 G A 1: 53,207,608 P312S probably damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Pygo1 A G 9: 72,942,926 D19G probably damaging Het
Sdr42e1 T A 8: 117,673,647 probably benign Het
Serpinb8 C T 1: 107,604,708 R177* probably null Het
Serpini1 A C 3: 75,616,714 S210R probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Smco3 T A 6: 136,831,249 Y209F probably damaging Het
Smtn C G 11: 3,524,708 S216T probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Sri T A 5: 8,056,641 probably null Het
Strn G A 17: 78,655,775 P716L probably damaging Het
Tmem167b T C 3: 108,558,897 Y69C probably damaging Het
Trpc7 A T 13: 56,789,760 F628I probably damaging Het
Trrap T A 5: 144,777,146 I65N possibly damaging Het
Tspan14 C A 14: 40,911,133 G201C probably damaging Het
Tti1 T A 2: 158,000,698 I804F probably benign Het
Unc5b C T 10: 60,777,438 G340R probably damaging Het
Usp13 C A 3: 32,837,856 Y61* probably null Het
Vmn1r230 T C 17: 20,846,882 M111T possibly damaging Het
Vmn2r87 A G 10: 130,472,149 V740A probably benign Het
Zbtb14 A G 17: 69,387,420 I38V probably benign Het
Zfp623 T C 15: 75,948,422 I409T probably damaging Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124061607 missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124061756 missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124053874 missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124050673 missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124061625 missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124061818 missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124026141 missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124026132 missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124039795 missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124050819 missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124039899 missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124062033 makesense probably null
R0083:Vmn2r26 UTSW 6 124053981 splice site probably null
R0682:Vmn2r26 UTSW 6 124061170 missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124061644 missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124053913 missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124050708 missense probably benign
R1579:Vmn2r26 UTSW 6 124039747 missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124061472 missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124061410 missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124024771 missense probably benign
R1956:Vmn2r26 UTSW 6 124053887 missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124061185 missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124061237 missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124039749 missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124061350 missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124025979 missense probably benign
R4490:Vmn2r26 UTSW 6 124050738 missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124061191 missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124061416 missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124053965 missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124026111 missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124061873 missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124061326 missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124050717 missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124039449 missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124025966 missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124061674 missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124039871 missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124039560 missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124061485 missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124061389 missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124026080 missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124061691 missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124039098 missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124039782 missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124061296 missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124039768 missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124061989 missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124025955 missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124039741 missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124039647 missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124039362 missense probably benign
R7696:Vmn2r26 UTSW 6 124061535 missense possibly damaging 0.94
R7831:Vmn2r26 UTSW 6 124039799 nonsense probably null
R8063:Vmn2r26 UTSW 6 124024955 missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124061928 missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124026036 missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124039618 missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124024918 missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124062024 missense probably benign
R9333:Vmn2r26 UTSW 6 124026050 missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124039374 missense probably benign
R9436:Vmn2r26 UTSW 6 124025867 missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124061178 missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124039489 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGACCTTCATTGTGGTTATGGC -3'
(R):5'- GAATTTCCACGGCCACCATG -3'

Sequencing Primer
(F):5'- GATGGTGACCCGACTCTCAAATG -3'
(R):5'- ACGGCCACCATGGTTTTG -3'
Posted On 2019-11-12