Incidental Mutation 'R7716:Vmn2r26'
ID 594915
Institutional Source Beutler Lab
Gene Symbol Vmn2r26
Ensembl Gene ENSMUSG00000096630
Gene Name vomeronasal 2, receptor 26
Synonyms V2r1b
MMRRC Submission 045774-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7716 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 124001717-124038994 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 124038704 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Asparagine at position 760 (Y760N)
Ref Sequence ENSEMBL: ENSMUSP00000032238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032238]
AlphaFold Q6TAC4
Predicted Effect probably damaging
Transcript: ENSMUST00000032238
AA Change: Y760N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032238
Gene: ENSMUSG00000096630
AA Change: Y760N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 82 471 1.5e-31 PFAM
Pfam:NCD3G 519 572 4.6e-25 PFAM
Pfam:7tm_3 603 840 1.5e-55 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal vomeronasal sensory neuron physiology and avnosmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,777,162 (GRCm39) C41Y possibly damaging Het
Abcg1 A G 17: 31,328,493 (GRCm39) I421V probably benign Het
Ank2 G T 3: 126,736,815 (GRCm39) T3023K unknown Het
Asb5 T A 8: 55,038,021 (GRCm39) H181Q probably benign Het
Asnsd1 C T 1: 53,386,902 (GRCm39) V242I probably benign Het
Atp2a1 C A 7: 126,061,359 (GRCm39) G46V possibly damaging Het
Birc6 A G 17: 74,869,056 (GRCm39) S335G probably damaging Het
Bmp1 A T 14: 70,715,362 (GRCm39) Y924* probably null Het
Ccdc3 T A 2: 5,143,113 (GRCm39) F123L probably benign Het
Col6a6 C A 9: 105,661,102 (GRCm39) V336L possibly damaging Het
Cpe T C 8: 65,064,431 (GRCm39) Y256C probably damaging Het
Creb1 T A 1: 64,605,420 (GRCm39) D62E possibly damaging Het
Cyp4a32 T A 4: 115,458,283 (GRCm39) Y38N probably damaging Het
Cyren T C 6: 34,852,516 (GRCm39) N60D possibly damaging Het
Dnajc1 A G 2: 18,224,684 (GRCm39) S390P probably benign Het
Edrf1 G A 7: 133,245,455 (GRCm39) E198K probably damaging Het
Ehmt1 A G 2: 24,774,511 (GRCm39) S98P probably damaging Het
Emsy G A 7: 98,248,973 (GRCm39) A812V unknown Het
Eppk1 A T 15: 75,991,703 (GRCm39) L1726* probably null Het
Flnb G T 14: 7,917,274 (GRCm38) K1584N possibly damaging Het
Gclc C T 9: 77,662,209 (GRCm39) R40W probably damaging Het
Gnpat A G 8: 125,603,673 (GRCm39) R194G probably benign Het
Gpd1 G A 15: 99,619,967 (GRCm39) S255N probably damaging Het
Il17re T C 6: 113,439,930 (GRCm39) probably null Het
Inpp5d G A 1: 87,593,121 (GRCm39) V74I probably damaging Het
Iqcb1 T C 16: 36,687,969 (GRCm39) S443P probably benign Het
Irak2 AC ACC 6: 113,667,859 (GRCm39) probably null Het
Kansl1l A G 1: 66,840,292 (GRCm39) V336A probably damaging Het
Klhdc4 T A 8: 122,556,159 (GRCm39) M21L unknown Het
Lgalsl2 T C 7: 5,362,819 (GRCm39) I150T possibly damaging Het
Lrguk C T 6: 34,072,474 (GRCm39) A588V probably damaging Het
Marchf5 T C 19: 37,197,822 (GRCm39) Y164H probably benign Het
Mbip T A 12: 56,392,473 (GRCm39) H38L probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,427,071 (GRCm39) probably benign Het
Myh8 A T 11: 67,189,478 (GRCm39) Q1218L possibly damaging Het
Ndc80 A T 17: 71,830,589 (GRCm39) I56K probably benign Het
Ndufs1 T C 1: 63,192,016 (GRCm39) D437G possibly damaging Het
Nlrc4 A G 17: 74,753,651 (GRCm39) L244P probably damaging Het
Or11h6 A G 14: 50,879,815 (GRCm39) T20A probably benign Het
Or14a258 A T 7: 86,035,262 (GRCm39) M202K probably benign Het
Pdc A C 1: 150,206,534 (GRCm39) D40A probably benign Het
Pdzd2 T C 15: 12,373,460 (GRCm39) Y2225C possibly damaging Het
Plce1 G T 19: 38,705,295 (GRCm39) G900V probably benign Het
Plpp1 A T 13: 112,993,323 (GRCm39) H86L probably benign Het
Plpp1 T G 13: 112,996,186 (GRCm39) F168C probably damaging Het
Pms1 G A 1: 53,246,767 (GRCm39) P312S probably damaging Het
Prf1 G A 10: 61,135,934 (GRCm39) R70H possibly damaging Het
Pygo1 A G 9: 72,850,208 (GRCm39) D19G probably damaging Het
Sdr42e1 T A 8: 118,400,386 (GRCm39) probably benign Het
Serpinb8 C T 1: 107,532,438 (GRCm39) R177* probably null Het
Serpini1 A C 3: 75,524,021 (GRCm39) S210R probably damaging Het
Slc29a4 C T 5: 142,704,261 (GRCm39) P305L probably benign Het
Smco3 T A 6: 136,808,247 (GRCm39) Y209F probably damaging Het
Smtn C G 11: 3,474,708 (GRCm39) S216T probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Sri T A 5: 8,106,641 (GRCm39) probably null Het
Strn G A 17: 78,963,204 (GRCm39) P716L probably damaging Het
Tmem167b T C 3: 108,466,213 (GRCm39) Y69C probably damaging Het
Trpc7 A T 13: 56,937,573 (GRCm39) F628I probably damaging Het
Trrap T A 5: 144,713,956 (GRCm39) I65N possibly damaging Het
Tspan14 C A 14: 40,633,090 (GRCm39) G201C probably damaging Het
Tti1 T A 2: 157,842,618 (GRCm39) I804F probably benign Het
Unc5b C T 10: 60,613,217 (GRCm39) G340R probably damaging Het
Usp13 C A 3: 32,892,005 (GRCm39) Y61* probably null Het
Vmn1r230 T C 17: 21,067,144 (GRCm39) M111T possibly damaging Het
Vmn2r87 A G 10: 130,308,018 (GRCm39) V740A probably benign Het
Zbtb14 A G 17: 69,694,415 (GRCm39) I38V probably benign Het
Zfp623 T C 15: 75,820,271 (GRCm39) I409T probably damaging Het
Zfp764l1 T A 7: 126,991,259 (GRCm39) M243L probably benign Het
Other mutations in Vmn2r26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Vmn2r26 APN 6 124,038,566 (GRCm39) missense probably benign 0.00
IGL01370:Vmn2r26 APN 6 124,038,715 (GRCm39) missense probably benign 0.08
IGL01603:Vmn2r26 APN 6 124,030,833 (GRCm39) missense probably damaging 1.00
IGL01651:Vmn2r26 APN 6 124,027,632 (GRCm39) missense probably benign 0.01
IGL02282:Vmn2r26 APN 6 124,038,584 (GRCm39) missense probably damaging 1.00
IGL02425:Vmn2r26 APN 6 124,038,777 (GRCm39) missense probably damaging 1.00
IGL02551:Vmn2r26 APN 6 124,003,100 (GRCm39) missense probably benign 0.11
IGL02690:Vmn2r26 APN 6 124,003,091 (GRCm39) missense probably benign 0.14
IGL03002:Vmn2r26 APN 6 124,016,754 (GRCm39) missense possibly damaging 0.78
IGL03270:Vmn2r26 APN 6 124,027,778 (GRCm39) missense probably benign 0.16
R0032:Vmn2r26 UTSW 6 124,016,858 (GRCm39) missense possibly damaging 0.72
R0052:Vmn2r26 UTSW 6 124,038,992 (GRCm39) makesense probably null
R0083:Vmn2r26 UTSW 6 124,030,940 (GRCm39) splice site probably null
R0682:Vmn2r26 UTSW 6 124,038,129 (GRCm39) missense probably damaging 0.97
R1061:Vmn2r26 UTSW 6 124,038,603 (GRCm39) missense probably benign 0.12
R1077:Vmn2r26 UTSW 6 124,030,872 (GRCm39) missense probably benign 0.00
R1263:Vmn2r26 UTSW 6 124,027,667 (GRCm39) missense probably benign
R1579:Vmn2r26 UTSW 6 124,016,706 (GRCm39) missense probably benign 0.00
R1741:Vmn2r26 UTSW 6 124,038,431 (GRCm39) missense probably damaging 1.00
R1834:Vmn2r26 UTSW 6 124,038,369 (GRCm39) missense possibly damaging 0.54
R1838:Vmn2r26 UTSW 6 124,001,730 (GRCm39) missense probably benign
R1956:Vmn2r26 UTSW 6 124,030,846 (GRCm39) missense probably damaging 1.00
R1996:Vmn2r26 UTSW 6 124,038,144 (GRCm39) missense probably damaging 1.00
R2140:Vmn2r26 UTSW 6 124,038,196 (GRCm39) missense probably benign 0.01
R2327:Vmn2r26 UTSW 6 124,016,708 (GRCm39) missense probably benign 0.07
R2417:Vmn2r26 UTSW 6 124,038,309 (GRCm39) missense probably damaging 1.00
R3930:Vmn2r26 UTSW 6 124,002,938 (GRCm39) missense probably benign
R4490:Vmn2r26 UTSW 6 124,027,697 (GRCm39) missense possibly damaging 0.47
R4629:Vmn2r26 UTSW 6 124,038,150 (GRCm39) missense possibly damaging 0.50
R4655:Vmn2r26 UTSW 6 124,038,375 (GRCm39) missense probably damaging 1.00
R4709:Vmn2r26 UTSW 6 124,030,924 (GRCm39) missense probably damaging 1.00
R4992:Vmn2r26 UTSW 6 124,003,070 (GRCm39) missense probably benign 0.00
R5297:Vmn2r26 UTSW 6 124,038,832 (GRCm39) missense probably damaging 1.00
R5482:Vmn2r26 UTSW 6 124,038,285 (GRCm39) missense possibly damaging 0.88
R5517:Vmn2r26 UTSW 6 124,027,676 (GRCm39) missense probably damaging 1.00
R5737:Vmn2r26 UTSW 6 124,016,408 (GRCm39) missense probably benign 0.00
R5739:Vmn2r26 UTSW 6 124,002,925 (GRCm39) missense probably benign 0.00
R5873:Vmn2r26 UTSW 6 124,038,633 (GRCm39) missense probably benign 0.01
R5907:Vmn2r26 UTSW 6 124,016,830 (GRCm39) missense probably benign 0.00
R6086:Vmn2r26 UTSW 6 124,016,519 (GRCm39) missense possibly damaging 0.48
R6134:Vmn2r26 UTSW 6 124,038,444 (GRCm39) missense probably damaging 0.97
R6391:Vmn2r26 UTSW 6 124,038,348 (GRCm39) missense probably damaging 1.00
R6428:Vmn2r26 UTSW 6 124,003,039 (GRCm39) missense probably benign 0.17
R6637:Vmn2r26 UTSW 6 124,038,650 (GRCm39) missense probably damaging 1.00
R6927:Vmn2r26 UTSW 6 124,016,057 (GRCm39) missense possibly damaging 0.93
R6953:Vmn2r26 UTSW 6 124,016,741 (GRCm39) missense probably benign 0.00
R7173:Vmn2r26 UTSW 6 124,038,255 (GRCm39) missense probably benign 0.16
R7206:Vmn2r26 UTSW 6 124,016,727 (GRCm39) missense probably benign 0.17
R7208:Vmn2r26 UTSW 6 124,038,948 (GRCm39) missense probably damaging 1.00
R7283:Vmn2r26 UTSW 6 124,002,914 (GRCm39) missense probably damaging 0.97
R7506:Vmn2r26 UTSW 6 124,016,700 (GRCm39) missense probably benign 0.00
R7672:Vmn2r26 UTSW 6 124,016,606 (GRCm39) missense probably benign 0.25
R7674:Vmn2r26 UTSW 6 124,016,321 (GRCm39) missense probably benign
R7696:Vmn2r26 UTSW 6 124,038,494 (GRCm39) missense possibly damaging 0.94
R7831:Vmn2r26 UTSW 6 124,016,758 (GRCm39) nonsense probably null
R8063:Vmn2r26 UTSW 6 124,001,914 (GRCm39) missense probably benign 0.00
R8331:Vmn2r26 UTSW 6 124,038,887 (GRCm39) missense probably benign 0.22
R8352:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8445:Vmn2r26 UTSW 6 124,002,995 (GRCm39) missense probably damaging 0.97
R8452:Vmn2r26 UTSW 6 124,016,577 (GRCm39) missense probably benign 0.09
R8681:Vmn2r26 UTSW 6 124,001,877 (GRCm39) missense probably benign 0.00
R8914:Vmn2r26 UTSW 6 124,038,983 (GRCm39) missense probably benign
R9333:Vmn2r26 UTSW 6 124,003,009 (GRCm39) missense probably benign 0.13
R9351:Vmn2r26 UTSW 6 124,016,333 (GRCm39) missense probably benign
R9436:Vmn2r26 UTSW 6 124,002,826 (GRCm39) missense probably damaging 1.00
R9515:Vmn2r26 UTSW 6 124,038,137 (GRCm39) missense probably damaging 1.00
RF010:Vmn2r26 UTSW 6 124,016,448 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- AGACCTTCATTGTGGTTATGGC -3'
(R):5'- GAATTTCCACGGCCACCATG -3'

Sequencing Primer
(F):5'- GATGGTGACCCGACTCTCAAATG -3'
(R):5'- ACGGCCACCATGGTTTTG -3'
Posted On 2019-11-12