Incidental Mutation 'R7716:Olfr304'
ID594918
Institutional Source Beutler Lab
Gene Symbol Olfr304
Ensembl Gene ENSMUSG00000062426
Gene Nameolfactory receptor 304
SynonymsGA_x6K02T2NHDJ-9721756-9722757, MOR219-3P
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R7716 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location86385657-86386658 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86386054 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 202 (M202K)
Ref Sequence ENSEMBL: ENSMUSP00000076449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077210]
Predicted Effect probably benign
Transcript: ENSMUST00000077210
AA Change: M202K

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000076449
Gene: ENSMUSG00000062426
AA Change: M202K

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 8.9e-38 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,869,829 C41Y possibly damaging Het
3110062M04Rik T C 6: 34,875,581 N60D possibly damaging Het
Abcg1 A G 17: 31,109,519 I421V probably benign Het
Ank2 G T 3: 126,943,166 T3023K unknown Het
Asb5 T A 8: 54,584,986 H181Q probably benign Het
Asnsd1 C T 1: 53,347,743 V242I probably benign Het
Atp2a1 C A 7: 126,462,187 G46V possibly damaging Het
Birc6 A G 17: 74,562,061 S335G probably damaging Het
Bmp1 A T 14: 70,477,922 Y924* probably null Het
Ccdc3 T A 2: 5,138,302 F123L probably benign Het
Col6a6 C A 9: 105,783,903 V336L possibly damaging Het
Cpe T C 8: 64,611,397 Y256C probably damaging Het
Creb1 T A 1: 64,566,261 D62E possibly damaging Het
Cyp4a32 T A 4: 115,601,086 Y38N probably damaging Het
Dnajc1 A G 2: 18,219,873 S390P probably benign Het
E430018J23Rik T A 7: 127,392,087 M243L probably benign Het
Edrf1 G A 7: 133,643,726 E198K probably damaging Het
Ehmt1 A G 2: 24,884,499 S98P probably damaging Het
Emsy G A 7: 98,599,766 A812V unknown Het
Eppk1 A T 15: 76,107,503 L1726* probably null Het
Flnb G T 14: 7,917,274 K1584N possibly damaging Het
Gclc C T 9: 77,754,927 R40W probably damaging Het
Gm5065 T C 7: 5,359,820 I150T possibly damaging Het
Gnpat A G 8: 124,876,934 R194G probably benign Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Il17re T C 6: 113,462,969 probably null Het
Inpp5d G A 1: 87,665,399 V74I probably damaging Het
Iqcb1 T C 16: 36,867,607 S443P probably benign Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Klhdc4 T A 8: 121,829,420 M21L unknown Het
Lrguk C T 6: 34,095,539 A588V probably damaging Het
March5 T C 19: 37,220,423 Y164H probably benign Het
Mbip T A 12: 56,345,688 H38L probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Myh8 A T 11: 67,298,652 Q1218L possibly damaging Het
Ndc80 A T 17: 71,523,594 I56K probably benign Het
Ndufs1 T C 1: 63,152,857 D437G possibly damaging Het
Nlrc4 A G 17: 74,446,656 L244P probably damaging Het
Olfr745 A G 14: 50,642,358 T20A probably benign Het
Pdc A C 1: 150,330,783 D40A probably benign Het
Pdzd2 T C 15: 12,373,374 Y2225C possibly damaging Het
Plce1 G T 19: 38,716,851 G900V probably benign Het
Plpp1 A T 13: 112,856,789 H86L probably benign Het
Plpp1 T G 13: 112,859,652 F168C probably damaging Het
Pms1 G A 1: 53,207,608 P312S probably damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Pygo1 A G 9: 72,942,926 D19G probably damaging Het
Sdr42e1 T A 8: 117,673,647 probably benign Het
Serpinb8 C T 1: 107,604,708 R177* probably null Het
Serpini1 A C 3: 75,616,714 S210R probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Smco3 T A 6: 136,831,249 Y209F probably damaging Het
Smtn C G 11: 3,524,708 S216T probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Sri T A 5: 8,056,641 probably null Het
Strn G A 17: 78,655,775 P716L probably damaging Het
Tmem167b T C 3: 108,558,897 Y69C probably damaging Het
Trpc7 A T 13: 56,789,760 F628I probably damaging Het
Trrap T A 5: 144,777,146 I65N possibly damaging Het
Tspan14 C A 14: 40,911,133 G201C probably damaging Het
Tti1 T A 2: 158,000,698 I804F probably benign Het
Unc5b C T 10: 60,777,438 G340R probably damaging Het
Usp13 C A 3: 32,837,856 Y61* probably null Het
Vmn1r230 T C 17: 20,846,882 M111T possibly damaging Het
Vmn2r26 T A 6: 124,061,745 Y760N probably damaging Het
Vmn2r87 A G 10: 130,472,149 V740A probably benign Het
Zbtb14 A G 17: 69,387,420 I38V probably benign Het
Zfp623 T C 15: 75,948,422 I409T probably damaging Het
Other mutations in Olfr304
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Olfr304 APN 7 86386000 missense possibly damaging 0.95
IGL02152:Olfr304 APN 7 86386043 missense probably benign 0.00
IGL02540:Olfr304 APN 7 86386178 missense possibly damaging 0.86
IGL03108:Olfr304 APN 7 86385721 missense possibly damaging 0.95
IGL03374:Olfr304 APN 7 86386366 missense probably damaging 1.00
R0040:Olfr304 UTSW 7 86386507 missense probably benign 0.01
R0130:Olfr304 UTSW 7 86386306 missense probably damaging 1.00
R0194:Olfr304 UTSW 7 86386374 nonsense probably null
R0267:Olfr304 UTSW 7 86386267 missense possibly damaging 0.64
R1026:Olfr304 UTSW 7 86386259 missense probably damaging 0.98
R1865:Olfr304 UTSW 7 86386561 missense probably damaging 1.00
R2090:Olfr304 UTSW 7 86386081 missense probably benign 0.01
R3607:Olfr304 UTSW 7 86385695 missense probably benign
R3861:Olfr304 UTSW 7 86386123 missense possibly damaging 0.60
R3909:Olfr304 UTSW 7 86385974 missense probably benign 0.05
R4113:Olfr304 UTSW 7 86386525 missense possibly damaging 0.83
R5268:Olfr304 UTSW 7 86385659 makesense probably null
R5649:Olfr304 UTSW 7 86386313 missense probably damaging 1.00
R6343:Olfr304 UTSW 7 86385851 nonsense probably null
X0054:Olfr304 UTSW 7 86385730 missense probably benign 0.00
X0063:Olfr304 UTSW 7 86386492 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGCACAGTATACAGCACAG -3'
(R):5'- TCCTGGGCTACTGGAATTCTG -3'

Sequencing Primer
(F):5'- TATCTGAGGGAGGCTTCAGATAGAC -3'
(R):5'- CTGTTTGGAGCTTTATACACAGC -3'
Posted On2019-11-12