Incidental Mutation 'R7716:Sdr42e1'
ID594925
Institutional Source Beutler Lab
Gene Symbol Sdr42e1
Ensembl Gene ENSMUSG00000034308
Gene Nameshort chain dehydrogenase/reductase family 42E, member 1
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7716 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location117661399-117673689 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) T to A at 117673647 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037955] [ENSMUST00000173522] [ENSMUST00000174450]
Predicted Effect probably benign
Transcript: ENSMUST00000037955
SMART Domains Protein: ENSMUSP00000044457
Gene: ENSMUSG00000034308

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 9 241 4.2e-14 PFAM
Pfam:Polysacc_synt_2 11 129 7.1e-11 PFAM
Pfam:NAD_binding_10 11 239 3.3e-10 PFAM
Pfam:Epimerase 11 255 6.7e-29 PFAM
Pfam:3Beta_HSD 12 285 3.1e-69 PFAM
Pfam:NAD_binding_4 27 233 7.1e-14 PFAM
transmembrane domain 367 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173522
SMART Domains Protein: ENSMUSP00000133782
Gene: ENSMUSG00000034308

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 9 208 2.4e-13 PFAM
Pfam:Polysacc_synt_2 11 129 5.2e-11 PFAM
Pfam:Epimerase 11 250 4.3e-28 PFAM
Pfam:GDP_Man_Dehyd 12 273 1.3e-9 PFAM
Pfam:3Beta_HSD 12 285 4.7e-69 PFAM
Pfam:NAD_binding_4 27 233 2.1e-11 PFAM
transmembrane domain 367 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174450
SMART Domains Protein: ENSMUSP00000133837
Gene: ENSMUSG00000034308

DomainStartEndE-ValueType
Pfam:adh_short 9 136 1.1e-6 PFAM
Pfam:RmlD_sub_bind 9 184 6.7e-15 PFAM
Pfam:Polysacc_synt_2 11 129 6e-12 PFAM
Pfam:Epimerase 11 176 1.8e-21 PFAM
Pfam:NAD_binding_10 11 189 4.8e-10 PFAM
Pfam:3Beta_HSD 12 189 5.4e-43 PFAM
Pfam:NAD_binding_4 25 186 6.6e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,869,829 C41Y possibly damaging Het
3110062M04Rik T C 6: 34,875,581 N60D possibly damaging Het
Abcg1 A G 17: 31,109,519 I421V probably benign Het
Ank2 G T 3: 126,943,166 T3023K unknown Het
Asb5 T A 8: 54,584,986 H181Q probably benign Het
Asnsd1 C T 1: 53,347,743 V242I probably benign Het
Atp2a1 C A 7: 126,462,187 G46V possibly damaging Het
Birc6 A G 17: 74,562,061 S335G probably damaging Het
Bmp1 A T 14: 70,477,922 Y924* probably null Het
Ccdc3 T A 2: 5,138,302 F123L probably benign Het
Col6a6 C A 9: 105,783,903 V336L possibly damaging Het
Cpe T C 8: 64,611,397 Y256C probably damaging Het
Creb1 T A 1: 64,566,261 D62E possibly damaging Het
Cyp4a32 T A 4: 115,601,086 Y38N probably damaging Het
Dnajc1 A G 2: 18,219,873 S390P probably benign Het
E430018J23Rik T A 7: 127,392,087 M243L probably benign Het
Edrf1 G A 7: 133,643,726 E198K probably damaging Het
Ehmt1 A G 2: 24,884,499 S98P probably damaging Het
Emsy G A 7: 98,599,766 A812V unknown Het
Eppk1 A T 15: 76,107,503 L1726* probably null Het
Flnb G T 14: 7,917,274 K1584N possibly damaging Het
Gclc C T 9: 77,754,927 R40W probably damaging Het
Gm5065 T C 7: 5,359,820 I150T possibly damaging Het
Gnpat A G 8: 124,876,934 R194G probably benign Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Il17re T C 6: 113,462,969 probably null Het
Inpp5d G A 1: 87,665,399 V74I probably damaging Het
Iqcb1 T C 16: 36,867,607 S443P probably benign Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Klhdc4 T A 8: 121,829,420 M21L unknown Het
Lrguk C T 6: 34,095,539 A588V probably damaging Het
March5 T C 19: 37,220,423 Y164H probably benign Het
Mbip T A 12: 56,345,688 H38L probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Myh8 A T 11: 67,298,652 Q1218L possibly damaging Het
Ndc80 A T 17: 71,523,594 I56K probably benign Het
Ndufs1 T C 1: 63,152,857 D437G possibly damaging Het
Nlrc4 A G 17: 74,446,656 L244P probably damaging Het
Olfr304 A T 7: 86,386,054 M202K probably benign Het
Olfr745 A G 14: 50,642,358 T20A probably benign Het
Pdc A C 1: 150,330,783 D40A probably benign Het
Pdzd2 T C 15: 12,373,374 Y2225C possibly damaging Het
Plce1 G T 19: 38,716,851 G900V probably benign Het
Plpp1 A T 13: 112,856,789 H86L probably benign Het
Plpp1 T G 13: 112,859,652 F168C probably damaging Het
Pms1 G A 1: 53,207,608 P312S probably damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Pygo1 A G 9: 72,942,926 D19G probably damaging Het
Serpinb8 C T 1: 107,604,708 R177* probably null Het
Serpini1 A C 3: 75,616,714 S210R probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Smco3 T A 6: 136,831,249 Y209F probably damaging Het
Smtn C G 11: 3,524,708 S216T probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Sri T A 5: 8,056,641 probably null Het
Strn G A 17: 78,655,775 P716L probably damaging Het
Tmem167b T C 3: 108,558,897 Y69C probably damaging Het
Trpc7 A T 13: 56,789,760 F628I probably damaging Het
Trrap T A 5: 144,777,146 I65N possibly damaging Het
Tspan14 C A 14: 40,911,133 G201C probably damaging Het
Tti1 T A 2: 158,000,698 I804F probably benign Het
Unc5b C T 10: 60,777,438 G340R probably damaging Het
Usp13 C A 3: 32,837,856 Y61* probably null Het
Vmn1r230 T C 17: 20,846,882 M111T possibly damaging Het
Vmn2r26 T A 6: 124,061,745 Y760N probably damaging Het
Vmn2r87 A G 10: 130,472,149 V740A probably benign Het
Zbtb14 A G 17: 69,387,420 I38V probably benign Het
Zfp623 T C 15: 75,948,422 I409T probably damaging Het
Other mutations in Sdr42e1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Sdr42e1 APN 8 117663443 missense probably damaging 1.00
IGL01613:Sdr42e1 APN 8 117662937 missense probably benign 0.14
PIT4581001:Sdr42e1 UTSW 8 117663518 missense probably damaging 0.99
R0194:Sdr42e1 UTSW 8 117663109 missense probably damaging 1.00
R1055:Sdr42e1 UTSW 8 117663584 missense probably damaging 0.98
R2108:Sdr42e1 UTSW 8 117665024 missense probably damaging 0.99
R2176:Sdr42e1 UTSW 8 117662877 missense possibly damaging 0.63
R2907:Sdr42e1 UTSW 8 117662772 missense probably damaging 0.99
R4551:Sdr42e1 UTSW 8 117663608 missense probably benign 0.01
R4651:Sdr42e1 UTSW 8 117663621 missense probably benign 0.01
R5148:Sdr42e1 UTSW 8 117663603 missense probably damaging 1.00
R5240:Sdr42e1 UTSW 8 117663282 missense probably benign 0.00
R6242:Sdr42e1 UTSW 8 117663197 missense possibly damaging 0.87
R7417:Sdr42e1 UTSW 8 117662751 missense probably benign 0.04
R7995:Sdr42e1 UTSW 8 117663268 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAATGGACACTTCAGGCTCC -3'
(R):5'- GAAACCGGCTGAGCTAAACC -3'

Sequencing Primer
(F):5'- ATGGACACTTCAGGCTCCTTTCAC -3'
(R):5'- AGGAGTCTAGATGACCCTCTC -3'
Posted On2019-11-12