Incidental Mutation 'R7716:Klhdc4'
ID594926
Institutional Source Beutler Lab
Gene Symbol Klhdc4
Ensembl Gene ENSMUSG00000040263
Gene Namekelch domain containing 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R7716 (G1)
Quality Score172.009
Status Not validated
Chromosome8
Chromosomal Location121796313-121829569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121829420 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 21 (M21L)
Ref Sequence ENSEMBL: ENSMUSP00000043439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045884] [ENSMUST00000127664] [ENSMUST00000174192] [ENSMUST00000174255] [ENSMUST00000174665] [ENSMUST00000174717]
Predicted Effect unknown
Transcript: ENSMUST00000045884
AA Change: M21L
SMART Domains Protein: ENSMUSP00000043439
Gene: ENSMUSG00000040263
AA Change: M21L

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 118 8.3e-11 PFAM
Pfam:Kelch_3 75 125 1.7e-9 PFAM
Pfam:Kelch_6 118 174 2.4e-9 PFAM
Pfam:Kelch_4 118 175 3e-8 PFAM
Pfam:Kelch_3 131 185 2e-8 PFAM
Pfam:Kelch_5 173 216 7.5e-9 PFAM
Pfam:Kelch_3 186 239 2.1e-6 PFAM
Pfam:Kelch_1 295 345 4.6e-6 PFAM
Pfam:Kelch_2 295 349 2.1e-7 PFAM
low complexity region 489 520 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174192
AA Change: M21L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000134487
Gene: ENSMUSG00000040263
AA Change: M21L

DomainStartEndE-ValueType
Pfam:Kelch_3 32 70 1.5e-6 PFAM
Pfam:Kelch_6 61 117 1.9e-8 PFAM
Pfam:Kelch_4 61 118 6.9e-8 PFAM
Pfam:Kelch_3 74 128 4.6e-8 PFAM
Pfam:Kelch_5 116 159 1.4e-7 PFAM
Pfam:Kelch_4 119 172 2.2e-6 PFAM
Pfam:Kelch_3 129 182 7e-7 PFAM
Pfam:Kelch_2 238 292 1.8e-7 PFAM
low complexity region 432 463 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174255
AA Change: M21L
Predicted Effect unknown
Transcript: ENSMUST00000174665
AA Change: M21L
SMART Domains Protein: ENSMUSP00000134474
Gene: ENSMUSG00000040263
AA Change: M21L

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 57 67 N/A INTRINSIC
low complexity region 104 114 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174717
AA Change: M21L
SMART Domains Protein: ENSMUSP00000134361
Gene: ENSMUSG00000040263
AA Change: M21L

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
Pfam:Kelch_4 63 117 1.4e-8 PFAM
Pfam:Kelch_3 75 127 9.6e-11 PFAM
Pfam:Kelch_4 118 170 2.3e-7 PFAM
Pfam:Kelch_6 118 174 9.3e-9 PFAM
low complexity region 191 202 N/A INTRINSIC
Pfam:Kelch_2 264 318 2e-7 PFAM
low complexity region 458 489 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,869,829 C41Y possibly damaging Het
3110062M04Rik T C 6: 34,875,581 N60D possibly damaging Het
Abcg1 A G 17: 31,109,519 I421V probably benign Het
Ank2 G T 3: 126,943,166 T3023K unknown Het
Asb5 T A 8: 54,584,986 H181Q probably benign Het
Asnsd1 C T 1: 53,347,743 V242I probably benign Het
Atp2a1 C A 7: 126,462,187 G46V possibly damaging Het
Birc6 A G 17: 74,562,061 S335G probably damaging Het
Bmp1 A T 14: 70,477,922 Y924* probably null Het
Ccdc3 T A 2: 5,138,302 F123L probably benign Het
Col6a6 C A 9: 105,783,903 V336L possibly damaging Het
Cpe T C 8: 64,611,397 Y256C probably damaging Het
Creb1 T A 1: 64,566,261 D62E possibly damaging Het
Cyp4a32 T A 4: 115,601,086 Y38N probably damaging Het
Dnajc1 A G 2: 18,219,873 S390P probably benign Het
E430018J23Rik T A 7: 127,392,087 M243L probably benign Het
Edrf1 G A 7: 133,643,726 E198K probably damaging Het
Ehmt1 A G 2: 24,884,499 S98P probably damaging Het
Emsy G A 7: 98,599,766 A812V unknown Het
Eppk1 A T 15: 76,107,503 L1726* probably null Het
Flnb G T 14: 7,917,274 K1584N possibly damaging Het
Gclc C T 9: 77,754,927 R40W probably damaging Het
Gm5065 T C 7: 5,359,820 I150T possibly damaging Het
Gnpat A G 8: 124,876,934 R194G probably benign Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Il17re T C 6: 113,462,969 probably null Het
Inpp5d G A 1: 87,665,399 V74I probably damaging Het
Iqcb1 T C 16: 36,867,607 S443P probably benign Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Lrguk C T 6: 34,095,539 A588V probably damaging Het
March5 T C 19: 37,220,423 Y164H probably benign Het
Mbip T A 12: 56,345,688 H38L probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Myh8 A T 11: 67,298,652 Q1218L possibly damaging Het
Ndc80 A T 17: 71,523,594 I56K probably benign Het
Ndufs1 T C 1: 63,152,857 D437G possibly damaging Het
Nlrc4 A G 17: 74,446,656 L244P probably damaging Het
Olfr304 A T 7: 86,386,054 M202K probably benign Het
Olfr745 A G 14: 50,642,358 T20A probably benign Het
Pdc A C 1: 150,330,783 D40A probably benign Het
Pdzd2 T C 15: 12,373,374 Y2225C possibly damaging Het
Plce1 G T 19: 38,716,851 G900V probably benign Het
Plpp1 A T 13: 112,856,789 H86L probably benign Het
Plpp1 T G 13: 112,859,652 F168C probably damaging Het
Pms1 G A 1: 53,207,608 P312S probably damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Pygo1 A G 9: 72,942,926 D19G probably damaging Het
Sdr42e1 T A 8: 117,673,647 probably benign Het
Serpinb8 C T 1: 107,604,708 R177* probably null Het
Serpini1 A C 3: 75,616,714 S210R probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Smco3 T A 6: 136,831,249 Y209F probably damaging Het
Smtn C G 11: 3,524,708 S216T probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Sri T A 5: 8,056,641 probably null Het
Strn G A 17: 78,655,775 P716L probably damaging Het
Tmem167b T C 3: 108,558,897 Y69C probably damaging Het
Trpc7 A T 13: 56,789,760 F628I probably damaging Het
Trrap T A 5: 144,777,146 I65N possibly damaging Het
Tspan14 C A 14: 40,911,133 G201C probably damaging Het
Tti1 T A 2: 158,000,698 I804F probably benign Het
Unc5b C T 10: 60,777,438 G340R probably damaging Het
Usp13 C A 3: 32,837,856 Y61* probably null Het
Vmn1r230 T C 17: 20,846,882 M111T possibly damaging Het
Vmn2r26 T A 6: 124,061,745 Y760N probably damaging Het
Vmn2r87 A G 10: 130,472,149 V740A probably benign Het
Zbtb14 A G 17: 69,387,420 I38V probably benign Het
Zfp623 T C 15: 75,948,422 I409T probably damaging Het
Other mutations in Klhdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Klhdc4 APN 8 121821843 nonsense probably null
IGL01678:Klhdc4 APN 8 121796938 missense possibly damaging 0.73
kilimanjaro UTSW 8 121813790 nonsense probably null
R0577:Klhdc4 UTSW 8 121821351 missense probably damaging 0.99
R0881:Klhdc4 UTSW 8 121799487 nonsense probably null
R1710:Klhdc4 UTSW 8 121799487 nonsense probably null
R2993:Klhdc4 UTSW 8 121806581 nonsense probably null
R3028:Klhdc4 UTSW 8 121799549 missense probably damaging 1.00
R3109:Klhdc4 UTSW 8 121821334 missense probably damaging 1.00
R3711:Klhdc4 UTSW 8 121798055 missense probably benign
R4132:Klhdc4 UTSW 8 121798065 missense possibly damaging 0.79
R4601:Klhdc4 UTSW 8 121799527 missense probably damaging 1.00
R4644:Klhdc4 UTSW 8 121822000 intron probably benign
R4758:Klhdc4 UTSW 8 121798044 missense probably benign 0.00
R4999:Klhdc4 UTSW 8 121796603 missense probably benign 0.00
R5177:Klhdc4 UTSW 8 121813790 nonsense probably null
R5364:Klhdc4 UTSW 8 121806636 intron probably benign
R5475:Klhdc4 UTSW 8 121799572 missense possibly damaging 0.67
R5705:Klhdc4 UTSW 8 121804993 missense probably benign 0.01
R6248:Klhdc4 UTSW 8 121813768 missense probably damaging 1.00
R6326:Klhdc4 UTSW 8 121805054 missense probably damaging 1.00
R6626:Klhdc4 UTSW 8 121820162 missense probably benign 0.43
R7274:Klhdc4 UTSW 8 121799658 critical splice acceptor site probably null
R8430:Klhdc4 UTSW 8 121799513 missense possibly damaging 0.82
R8841:Klhdc4 UTSW 8 121796641 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- GAGTTTCGGGACTGCAAAGG -3'
(R):5'- CAAAGTACTGGTGGGATCGG -3'

Sequencing Primer
(F):5'- GACTGCAAAGGGACCCG -3'
(R):5'- ATCGGCTGCTCCACGGAAC -3'
Posted On2019-11-12