Incidental Mutation 'R7716:Gclc'
ID594929
Institutional Source Beutler Lab
Gene Symbol Gclc
Ensembl Gene ENSMUSG00000032350
Gene Nameglutamate-cysteine ligase, catalytic subunit
SynonymsD9Wsu168e, gamma GCS-HS, GLCL-H, Glclc
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7716 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location77754535-77794485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 77754927 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 40 (R40W)
Ref Sequence ENSEMBL: ENSMUSP00000034905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034905]
Predicted Effect probably damaging
Transcript: ENSMUST00000034905
AA Change: R40W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034905
Gene: ENSMUSG00000032350
AA Change: R40W

DomainStartEndE-ValueType
Pfam:GCS 236 608 1.3e-185 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glutamate-cysteine ligase, also known as gamma-glutamylcysteine synthetase is the first rate-limiting enzyme of glutathione synthesis. The enzyme consists of two subunits, a heavy catalytic subunit and a light regulatory subunit. This locus encodes the catalytic subunit, while the regulatory subunit is derived from a different gene located on chromosome 1p22-p21. Mutations at this locus have been associated with hemolytic anemia due to deficiency of gamma-glutamylcysteine synthetase and susceptibility to myocardial infarction.[provided by RefSeq, Oct 2010]
PHENOTYPE: Homozygous mutant mice are embryonic lethal. One model shows lethality before E13 while another shows lethality between E7.5-E8.5. In this second model, embryos are arrested at the egg cylinder stage, fail to gastrulate, do not form mesoderm, and exhibitincreased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,869,829 C41Y possibly damaging Het
3110062M04Rik T C 6: 34,875,581 N60D possibly damaging Het
Abcg1 A G 17: 31,109,519 I421V probably benign Het
Ank2 G T 3: 126,943,166 T3023K unknown Het
Asb5 T A 8: 54,584,986 H181Q probably benign Het
Asnsd1 C T 1: 53,347,743 V242I probably benign Het
Atp2a1 C A 7: 126,462,187 G46V possibly damaging Het
Birc6 A G 17: 74,562,061 S335G probably damaging Het
Bmp1 A T 14: 70,477,922 Y924* probably null Het
Ccdc3 T A 2: 5,138,302 F123L probably benign Het
Col6a6 C A 9: 105,783,903 V336L possibly damaging Het
Cpe T C 8: 64,611,397 Y256C probably damaging Het
Creb1 T A 1: 64,566,261 D62E possibly damaging Het
Cyp4a32 T A 4: 115,601,086 Y38N probably damaging Het
Dnajc1 A G 2: 18,219,873 S390P probably benign Het
E430018J23Rik T A 7: 127,392,087 M243L probably benign Het
Edrf1 G A 7: 133,643,726 E198K probably damaging Het
Ehmt1 A G 2: 24,884,499 S98P probably damaging Het
Emsy G A 7: 98,599,766 A812V unknown Het
Eppk1 A T 15: 76,107,503 L1726* probably null Het
Flnb G T 14: 7,917,274 K1584N possibly damaging Het
Gm5065 T C 7: 5,359,820 I150T possibly damaging Het
Gnpat A G 8: 124,876,934 R194G probably benign Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Il17re T C 6: 113,462,969 probably null Het
Inpp5d G A 1: 87,665,399 V74I probably damaging Het
Iqcb1 T C 16: 36,867,607 S443P probably benign Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Klhdc4 T A 8: 121,829,420 M21L unknown Het
Lrguk C T 6: 34,095,539 A588V probably damaging Het
March5 T C 19: 37,220,423 Y164H probably benign Het
Mbip T A 12: 56,345,688 H38L probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,293,999 probably benign Het
Myh8 A T 11: 67,298,652 Q1218L possibly damaging Het
Ndc80 A T 17: 71,523,594 I56K probably benign Het
Ndufs1 T C 1: 63,152,857 D437G possibly damaging Het
Nlrc4 A G 17: 74,446,656 L244P probably damaging Het
Olfr304 A T 7: 86,386,054 M202K probably benign Het
Olfr745 A G 14: 50,642,358 T20A probably benign Het
Pdc A C 1: 150,330,783 D40A probably benign Het
Pdzd2 T C 15: 12,373,374 Y2225C possibly damaging Het
Plce1 G T 19: 38,716,851 G900V probably benign Het
Plpp1 A T 13: 112,856,789 H86L probably benign Het
Plpp1 T G 13: 112,859,652 F168C probably damaging Het
Pms1 G A 1: 53,207,608 P312S probably damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Pygo1 A G 9: 72,942,926 D19G probably damaging Het
Sdr42e1 T A 8: 117,673,647 probably benign Het
Serpinb8 C T 1: 107,604,708 R177* probably null Het
Serpini1 A C 3: 75,616,714 S210R probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Smco3 T A 6: 136,831,249 Y209F probably damaging Het
Smtn C G 11: 3,524,708 S216T probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Sri T A 5: 8,056,641 probably null Het
Strn G A 17: 78,655,775 P716L probably damaging Het
Tmem167b T C 3: 108,558,897 Y69C probably damaging Het
Trpc7 A T 13: 56,789,760 F628I probably damaging Het
Trrap T A 5: 144,777,146 I65N possibly damaging Het
Tspan14 C A 14: 40,911,133 G201C probably damaging Het
Tti1 T A 2: 158,000,698 I804F probably benign Het
Unc5b C T 10: 60,777,438 G340R probably damaging Het
Usp13 C A 3: 32,837,856 Y61* probably null Het
Vmn1r230 T C 17: 20,846,882 M111T possibly damaging Het
Vmn2r26 T A 6: 124,061,745 Y760N probably damaging Het
Vmn2r87 A G 10: 130,472,149 V740A probably benign Het
Zbtb14 A G 17: 69,387,420 I38V probably benign Het
Zfp623 T C 15: 75,948,422 I409T probably damaging Het
Other mutations in Gclc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02026:Gclc APN 9 77792060 missense probably benign
IGL02059:Gclc APN 9 77787816 missense probably damaging 1.00
R0671:Gclc UTSW 9 77786798 missense probably damaging 1.00
R1469:Gclc UTSW 9 77781137 missense probably benign 0.01
R1469:Gclc UTSW 9 77781137 missense probably benign 0.01
R1700:Gclc UTSW 9 77776289 missense probably benign 0.04
R3120:Gclc UTSW 9 77781270 missense possibly damaging 0.84
R3830:Gclc UTSW 9 77791960 missense probably benign 0.24
R6747:Gclc UTSW 9 77788245 missense probably damaging 0.96
R7028:Gclc UTSW 9 77788216 missense probably damaging 1.00
R7120:Gclc UTSW 9 77786750 missense probably damaging 1.00
R7242:Gclc UTSW 9 77785371 missense probably benign 0.00
R7329:Gclc UTSW 9 77776191 missense probably damaging 1.00
X0021:Gclc UTSW 9 77788209 missense probably damaging 1.00
Z1088:Gclc UTSW 9 77781367 splice site probably null
Z1177:Gclc UTSW 9 77786739 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTTTGGGTCGCAAGTAGGAAGC -3'
(R):5'- GGCAGATATTCACACTCCTCC -3'

Sequencing Primer
(F):5'- CAAGTAGGAAGCCCGTGCAC -3'
(R):5'- ACACTCCTCCCGCTCAGG -3'
Posted On2019-11-12