Incidental Mutation 'R7716:Bmp1'
ID 594943
Institutional Source Beutler Lab
Gene Symbol Bmp1
Ensembl Gene ENSMUSG00000022098
Gene Name bone morphogenetic protein 1
Synonyms
MMRRC Submission 045774-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7716 (G1)
Quality Score 225.009
Status Not validated
Chromosome 14
Chromosomal Location 70711998-70757674 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 70715362 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 924 (Y924*)
Ref Sequence ENSEMBL: ENSMUSP00000022693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022693] [ENSMUST00000226906] [ENSMUST00000227944]
AlphaFold P98063
Predicted Effect probably null
Transcript: ENSMUST00000022693
AA Change: Y924*
SMART Domains Protein: ENSMUSP00000022693
Gene: ENSMUSG00000022098
AA Change: Y924*

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
ZnMc 131 273 1.32e-54 SMART
CUB 327 439 4.35e-43 SMART
CUB 440 552 7.86e-50 SMART
EGF_CA 552 593 5.03e-11 SMART
CUB 596 708 1.13e-50 SMART
EGF_CA 708 748 4.81e-8 SMART
CUB 752 864 3.99e-51 SMART
CUB 865 981 7.35e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000226906
Predicted Effect probably benign
Transcript: ENSMUST00000227944
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a metalloproteinase that plays an essential role in the formation of the extracellular matrix and is also able to induce ectopic bone formation. Unlike other bone morphogenetic proteins, the protein encoded by this gene is not closely related to transforming growth factor-beta. This protein plays in role several developmental processes. In humans, mutations in this gene are associated with osteogenesis imperfecta and with increased bone mineral density and multiple recurrent fractures. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous targeted mutant embryos have reduced ossification of the skull, persistent herniation of the gut, abnormal collagen fibrils in the amnion, and die at birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,777,162 (GRCm39) C41Y possibly damaging Het
Abcg1 A G 17: 31,328,493 (GRCm39) I421V probably benign Het
Ank2 G T 3: 126,736,815 (GRCm39) T3023K unknown Het
Asb5 T A 8: 55,038,021 (GRCm39) H181Q probably benign Het
Asnsd1 C T 1: 53,386,902 (GRCm39) V242I probably benign Het
Atp2a1 C A 7: 126,061,359 (GRCm39) G46V possibly damaging Het
Birc6 A G 17: 74,869,056 (GRCm39) S335G probably damaging Het
Ccdc3 T A 2: 5,143,113 (GRCm39) F123L probably benign Het
Col6a6 C A 9: 105,661,102 (GRCm39) V336L possibly damaging Het
Cpe T C 8: 65,064,431 (GRCm39) Y256C probably damaging Het
Creb1 T A 1: 64,605,420 (GRCm39) D62E possibly damaging Het
Cyp4a32 T A 4: 115,458,283 (GRCm39) Y38N probably damaging Het
Cyren T C 6: 34,852,516 (GRCm39) N60D possibly damaging Het
Dnajc1 A G 2: 18,224,684 (GRCm39) S390P probably benign Het
Edrf1 G A 7: 133,245,455 (GRCm39) E198K probably damaging Het
Ehmt1 A G 2: 24,774,511 (GRCm39) S98P probably damaging Het
Emsy G A 7: 98,248,973 (GRCm39) A812V unknown Het
Eppk1 A T 15: 75,991,703 (GRCm39) L1726* probably null Het
Flnb G T 14: 7,917,274 (GRCm38) K1584N possibly damaging Het
Gclc C T 9: 77,662,209 (GRCm39) R40W probably damaging Het
Gnpat A G 8: 125,603,673 (GRCm39) R194G probably benign Het
Gpd1 G A 15: 99,619,967 (GRCm39) S255N probably damaging Het
Il17re T C 6: 113,439,930 (GRCm39) probably null Het
Inpp5d G A 1: 87,593,121 (GRCm39) V74I probably damaging Het
Iqcb1 T C 16: 36,687,969 (GRCm39) S443P probably benign Het
Irak2 AC ACC 6: 113,667,859 (GRCm39) probably null Het
Kansl1l A G 1: 66,840,292 (GRCm39) V336A probably damaging Het
Klhdc4 T A 8: 122,556,159 (GRCm39) M21L unknown Het
Lgalsl2 T C 7: 5,362,819 (GRCm39) I150T possibly damaging Het
Lrguk C T 6: 34,072,474 (GRCm39) A588V probably damaging Het
Marchf5 T C 19: 37,197,822 (GRCm39) Y164H probably benign Het
Mbip T A 12: 56,392,473 (GRCm39) H38L probably benign Het
Megf10 GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA GGCAGCAACAGCACCAGCAGCA 18: 57,427,071 (GRCm39) probably benign Het
Myh8 A T 11: 67,189,478 (GRCm39) Q1218L possibly damaging Het
Ndc80 A T 17: 71,830,589 (GRCm39) I56K probably benign Het
Ndufs1 T C 1: 63,192,016 (GRCm39) D437G possibly damaging Het
Nlrc4 A G 17: 74,753,651 (GRCm39) L244P probably damaging Het
Or11h6 A G 14: 50,879,815 (GRCm39) T20A probably benign Het
Or14a258 A T 7: 86,035,262 (GRCm39) M202K probably benign Het
Pdc A C 1: 150,206,534 (GRCm39) D40A probably benign Het
Pdzd2 T C 15: 12,373,460 (GRCm39) Y2225C possibly damaging Het
Plce1 G T 19: 38,705,295 (GRCm39) G900V probably benign Het
Plpp1 A T 13: 112,993,323 (GRCm39) H86L probably benign Het
Plpp1 T G 13: 112,996,186 (GRCm39) F168C probably damaging Het
Pms1 G A 1: 53,246,767 (GRCm39) P312S probably damaging Het
Prf1 G A 10: 61,135,934 (GRCm39) R70H possibly damaging Het
Pygo1 A G 9: 72,850,208 (GRCm39) D19G probably damaging Het
Sdr42e1 T A 8: 118,400,386 (GRCm39) probably benign Het
Serpinb8 C T 1: 107,532,438 (GRCm39) R177* probably null Het
Serpini1 A C 3: 75,524,021 (GRCm39) S210R probably damaging Het
Slc29a4 C T 5: 142,704,261 (GRCm39) P305L probably benign Het
Smco3 T A 6: 136,808,247 (GRCm39) Y209F probably damaging Het
Smtn C G 11: 3,474,708 (GRCm39) S216T probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,453,579 (GRCm39) probably benign Het
Sri T A 5: 8,106,641 (GRCm39) probably null Het
Strn G A 17: 78,963,204 (GRCm39) P716L probably damaging Het
Tmem167b T C 3: 108,466,213 (GRCm39) Y69C probably damaging Het
Trpc7 A T 13: 56,937,573 (GRCm39) F628I probably damaging Het
Trrap T A 5: 144,713,956 (GRCm39) I65N possibly damaging Het
Tspan14 C A 14: 40,633,090 (GRCm39) G201C probably damaging Het
Tti1 T A 2: 157,842,618 (GRCm39) I804F probably benign Het
Unc5b C T 10: 60,613,217 (GRCm39) G340R probably damaging Het
Usp13 C A 3: 32,892,005 (GRCm39) Y61* probably null Het
Vmn1r230 T C 17: 21,067,144 (GRCm39) M111T possibly damaging Het
Vmn2r26 T A 6: 124,038,704 (GRCm39) Y760N probably damaging Het
Vmn2r87 A G 10: 130,308,018 (GRCm39) V740A probably benign Het
Zbtb14 A G 17: 69,694,415 (GRCm39) I38V probably benign Het
Zfp623 T C 15: 75,820,271 (GRCm39) I409T probably damaging Het
Zfp764l1 T A 7: 126,991,259 (GRCm39) M243L probably benign Het
Other mutations in Bmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Bmp1 APN 14 70,729,901 (GRCm39) missense probably damaging 1.00
IGL02065:Bmp1 APN 14 70,727,547 (GRCm39) missense probably damaging 0.99
IGL02065:Bmp1 APN 14 70,723,660 (GRCm39) missense probably damaging 0.97
IGL02349:Bmp1 APN 14 70,744,989 (GRCm39) missense possibly damaging 0.61
IGL02486:Bmp1 APN 14 70,742,216 (GRCm39) missense possibly damaging 0.48
PIT4519001:Bmp1 UTSW 14 70,727,469 (GRCm39) missense possibly damaging 0.65
R0394:Bmp1 UTSW 14 70,727,474 (GRCm39) missense probably damaging 0.99
R1371:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R1604:Bmp1 UTSW 14 70,745,444 (GRCm39) missense possibly damaging 0.66
R1732:Bmp1 UTSW 14 70,723,705 (GRCm39) missense possibly damaging 0.67
R1834:Bmp1 UTSW 14 70,746,271 (GRCm39) missense possibly damaging 0.73
R2008:Bmp1 UTSW 14 70,729,906 (GRCm39) missense probably damaging 1.00
R2197:Bmp1 UTSW 14 70,723,712 (GRCm39) missense possibly damaging 0.83
R3157:Bmp1 UTSW 14 70,729,547 (GRCm39) missense possibly damaging 0.63
R4397:Bmp1 UTSW 14 70,727,982 (GRCm39) splice site probably null
R4609:Bmp1 UTSW 14 70,715,406 (GRCm39) missense probably benign 0.00
R4613:Bmp1 UTSW 14 70,745,963 (GRCm39) missense probably damaging 1.00
R4675:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 0.99
R4796:Bmp1 UTSW 14 70,729,513 (GRCm39) splice site probably null
R4884:Bmp1 UTSW 14 70,712,655 (GRCm39) missense probably benign 0.01
R4905:Bmp1 UTSW 14 70,728,802 (GRCm39) missense probably benign 0.06
R5088:Bmp1 UTSW 14 70,723,659 (GRCm39) missense possibly damaging 0.84
R5225:Bmp1 UTSW 14 70,717,605 (GRCm39) missense probably damaging 0.97
R5271:Bmp1 UTSW 14 70,745,568 (GRCm39) missense probably benign 0.34
R5625:Bmp1 UTSW 14 70,723,606 (GRCm39) missense probably benign 0.19
R5653:Bmp1 UTSW 14 70,727,534 (GRCm39) missense probably benign 0.00
R6155:Bmp1 UTSW 14 70,745,447 (GRCm39) missense probably damaging 1.00
R6295:Bmp1 UTSW 14 70,728,823 (GRCm39) missense possibly damaging 0.88
R6618:Bmp1 UTSW 14 70,728,808 (GRCm39) missense probably damaging 1.00
R6649:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6653:Bmp1 UTSW 14 70,728,058 (GRCm39) missense probably damaging 1.00
R6951:Bmp1 UTSW 14 70,746,298 (GRCm39) missense probably benign 0.26
R6983:Bmp1 UTSW 14 70,745,647 (GRCm39) missense probably damaging 0.96
R7207:Bmp1 UTSW 14 70,717,000 (GRCm39) missense possibly damaging 0.56
R7500:Bmp1 UTSW 14 70,727,562 (GRCm39) missense probably benign 0.44
R7749:Bmp1 UTSW 14 70,730,284 (GRCm39) missense probably damaging 1.00
R7763:Bmp1 UTSW 14 70,729,524 (GRCm39) missense probably damaging 1.00
R7834:Bmp1 UTSW 14 70,746,005 (GRCm39) missense probably damaging 1.00
R8232:Bmp1 UTSW 14 70,757,329 (GRCm39) missense probably damaging 0.97
R8490:Bmp1 UTSW 14 70,727,573 (GRCm39) missense possibly damaging 0.94
R8827:Bmp1 UTSW 14 70,728,082 (GRCm39) missense probably damaging 1.00
R8945:Bmp1 UTSW 14 70,727,630 (GRCm39) missense probably damaging 1.00
R9178:Bmp1 UTSW 14 70,727,613 (GRCm39) missense possibly damaging 0.78
R9228:Bmp1 UTSW 14 70,757,338 (GRCm39) missense probably benign
R9621:Bmp1 UTSW 14 70,715,306 (GRCm39) missense probably benign 0.29
R9652:Bmp1 UTSW 14 70,715,360 (GRCm39) missense probably damaging 1.00
X0028:Bmp1 UTSW 14 70,745,977 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTCAGCCTAGTACCCTAG -3'
(R):5'- ATCATCACACACTGATCGGTC -3'

Sequencing Primer
(F):5'- TAGTACCCTAGGTCTCCAGGGATG -3'
(R):5'- ATCGGTCATCAGTGGTGATCAATC -3'
Posted On 2019-11-12