Incidental Mutation 'R7716:Megf10'
ID594957
Institutional Source Beutler Lab
Gene Symbol Megf10
Ensembl Gene ENSMUSG00000024593
Gene Namemultiple EGF-like-domains 10
Synonyms3000002B06Rik, LOC240312
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.554) question?
Stock #R7716 (G1)
Quality Score217.468
Status Not validated
Chromosome18
Chromosomal Location57133090-57297467 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) GGCAGCAACAGCACCAGCAGCAACAGCACCAGCAGCA to GGCAGCAACAGCACCAGCAGCA at 57293999 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]
Predicted Effect probably benign
Transcript: ENSMUST00000075770
SMART Domains Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
low complexity region 1131 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139892
SMART Domains Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 108 136 9.41e-2 SMART
EGF_Lam 152 191 3.57e-2 SMART
EGF 190 222 5.79e-2 SMART
EGF 233 265 1.78e-2 SMART
EGF_Lam 281 320 7.58e-6 SMART
EGF 319 351 7.13e-2 SMART
EGF_Lam 368 409 9.05e-4 SMART
EGF 408 440 8.78e-2 SMART
EGF 451 483 2.85e-1 SMART
EGF 494 526 2.02e-1 SMART
EGF_Lam 542 581 1.04e-3 SMART
EGF 580 612 1.91e-2 SMART
EGF 623 657 2.16e1 SMART
EGF 668 700 2.48e-1 SMART
EGF 711 743 2.81e0 SMART
EGF_Lam 759 798 4.16e-3 SMART
EGF 797 829 1.73e0 SMART
transmembrane domain 856 878 N/A INTRINSIC
low complexity region 1014 1026 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik G A 3: 68,869,829 C41Y possibly damaging Het
3110062M04Rik T C 6: 34,875,581 N60D possibly damaging Het
Abcg1 A G 17: 31,109,519 I421V probably benign Het
Ank2 G T 3: 126,943,166 T3023K unknown Het
Asb5 T A 8: 54,584,986 H181Q probably benign Het
Asnsd1 C T 1: 53,347,743 V242I probably benign Het
Atp2a1 C A 7: 126,462,187 G46V possibly damaging Het
Birc6 A G 17: 74,562,061 S335G probably damaging Het
Bmp1 A T 14: 70,477,922 Y924* probably null Het
Ccdc3 T A 2: 5,138,302 F123L probably benign Het
Col6a6 C A 9: 105,783,903 V336L possibly damaging Het
Cpe T C 8: 64,611,397 Y256C probably damaging Het
Creb1 T A 1: 64,566,261 D62E possibly damaging Het
Cyp4a32 T A 4: 115,601,086 Y38N probably damaging Het
Dnajc1 A G 2: 18,219,873 S390P probably benign Het
E430018J23Rik T A 7: 127,392,087 M243L probably benign Het
Edrf1 G A 7: 133,643,726 E198K probably damaging Het
Ehmt1 A G 2: 24,884,499 S98P probably damaging Het
Emsy G A 7: 98,599,766 A812V unknown Het
Eppk1 A T 15: 76,107,503 L1726* probably null Het
Flnb G T 14: 7,917,274 K1584N possibly damaging Het
Gclc C T 9: 77,754,927 R40W probably damaging Het
Gm5065 T C 7: 5,359,820 I150T possibly damaging Het
Gnpat A G 8: 124,876,934 R194G probably benign Het
Gpd1 G A 15: 99,722,086 S255N probably damaging Het
Il17re T C 6: 113,462,969 probably null Het
Inpp5d G A 1: 87,665,399 V74I probably damaging Het
Iqcb1 T C 16: 36,867,607 S443P probably benign Het
Irak2 AC ACC 6: 113,690,898 probably null Het
Kansl1l A G 1: 66,801,133 V336A probably damaging Het
Klhdc4 T A 8: 121,829,420 M21L unknown Het
Lrguk C T 6: 34,095,539 A588V probably damaging Het
March5 T C 19: 37,220,423 Y164H probably benign Het
Mbip T A 12: 56,345,688 H38L probably benign Het
Myh8 A T 11: 67,298,652 Q1218L possibly damaging Het
Ndc80 A T 17: 71,523,594 I56K probably benign Het
Ndufs1 T C 1: 63,152,857 D437G possibly damaging Het
Nlrc4 A G 17: 74,446,656 L244P probably damaging Het
Olfr304 A T 7: 86,386,054 M202K probably benign Het
Olfr745 A G 14: 50,642,358 T20A probably benign Het
Pdc A C 1: 150,330,783 D40A probably benign Het
Pdzd2 T C 15: 12,373,374 Y2225C possibly damaging Het
Plce1 G T 19: 38,716,851 G900V probably benign Het
Plpp1 A T 13: 112,856,789 H86L probably benign Het
Plpp1 T G 13: 112,859,652 F168C probably damaging Het
Pms1 G A 1: 53,207,608 P312S probably damaging Het
Prf1 G A 10: 61,300,155 R70H possibly damaging Het
Pygo1 A G 9: 72,942,926 D19G probably damaging Het
Sdr42e1 T A 8: 117,673,647 probably benign Het
Serpinb8 C T 1: 107,604,708 R177* probably null Het
Serpini1 A C 3: 75,616,714 S210R probably damaging Het
Slc29a4 C T 5: 142,718,506 P305L probably benign Het
Smco3 T A 6: 136,831,249 Y209F probably damaging Het
Smtn C G 11: 3,524,708 S216T probably benign Het
Son CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC CATGGACTCCCAGATGTTAGCAACTAGCTCTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCTCCATGGACTCCCAGATGTTAGCAAC 16: 91,656,691 probably benign Het
Sri T A 5: 8,056,641 probably null Het
Strn G A 17: 78,655,775 P716L probably damaging Het
Tmem167b T C 3: 108,558,897 Y69C probably damaging Het
Trpc7 A T 13: 56,789,760 F628I probably damaging Het
Trrap T A 5: 144,777,146 I65N possibly damaging Het
Tspan14 C A 14: 40,911,133 G201C probably damaging Het
Tti1 T A 2: 158,000,698 I804F probably benign Het
Unc5b C T 10: 60,777,438 G340R probably damaging Het
Usp13 C A 3: 32,837,856 Y61* probably null Het
Vmn1r230 T C 17: 20,846,882 M111T possibly damaging Het
Vmn2r26 T A 6: 124,061,745 Y760N probably damaging Het
Vmn2r87 A G 10: 130,472,149 V740A probably benign Het
Zbtb14 A G 17: 69,387,420 I38V probably benign Het
Zfp623 T C 15: 75,948,422 I409T probably damaging Het
Other mutations in Megf10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Megf10 APN 18 57240628 missense probably damaging 1.00
IGL00736:Megf10 APN 18 57292710 missense probably benign 0.35
IGL01631:Megf10 APN 18 57259797 missense possibly damaging 0.61
IGL02488:Megf10 APN 18 57292632 missense probably damaging 1.00
IGL02747:Megf10 APN 18 57290493 missense probably benign 0.43
IGL03298:Megf10 APN 18 57283838 nonsense probably null
megalodon UTSW 18 57287976 nonsense probably null
sharkie UTSW 18 57191185 nonsense probably null
IGL03046:Megf10 UTSW 18 57287983 missense possibly damaging 0.95
PIT4696001:Megf10 UTSW 18 57277688 missense probably damaging 1.00
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0020:Megf10 UTSW 18 57287893 missense possibly damaging 0.81
R0115:Megf10 UTSW 18 57259802 missense possibly damaging 0.67
R0455:Megf10 UTSW 18 57252982 missense probably benign 0.34
R0602:Megf10 UTSW 18 57262100 missense probably damaging 0.98
R0630:Megf10 UTSW 18 57287995 missense probably benign 0.14
R0652:Megf10 UTSW 18 57277724 missense probably benign 0.00
R0658:Megf10 UTSW 18 57252896 missense probably benign 0.00
R0761:Megf10 UTSW 18 57287976 nonsense probably null
R1013:Megf10 UTSW 18 57261219 missense probably benign 0.00
R1130:Megf10 UTSW 18 57262006 missense probably benign 0.06
R1451:Megf10 UTSW 18 57252859 missense probably damaging 0.97
R1699:Megf10 UTSW 18 57277730 splice site probably null
R1729:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1784:Megf10 UTSW 18 57240792 critical splice donor site probably null
R1870:Megf10 UTSW 18 57191185 nonsense probably null
R1961:Megf10 UTSW 18 57212354 missense probably damaging 0.97
R2094:Megf10 UTSW 18 57281713 nonsense probably null
R2213:Megf10 UTSW 18 57288009 nonsense probably null
R2853:Megf10 UTSW 18 57293931 missense probably damaging 1.00
R3772:Megf10 UTSW 18 57283862 missense probably benign 0.39
R3774:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3775:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3776:Megf10 UTSW 18 57277105 missense probably damaging 1.00
R3858:Megf10 UTSW 18 57275835 splice site probably benign
R3911:Megf10 UTSW 18 57289393 missense probably damaging 0.99
R3966:Megf10 UTSW 18 57180574 missense probably damaging 1.00
R4043:Megf10 UTSW 18 57259798 missense probably damaging 0.98
R4131:Megf10 UTSW 18 57180535 missense probably damaging 1.00
R4598:Megf10 UTSW 18 57189603 critical splice donor site probably null
R4598:Megf10 UTSW 18 57287812 missense probably damaging 1.00
R4726:Megf10 UTSW 18 57287792 missense probably benign 0.32
R4765:Megf10 UTSW 18 57287794 missense possibly damaging 0.56
R4874:Megf10 UTSW 18 57293858 missense probably benign 0.00
R4928:Megf10 UTSW 18 57240673 missense probably benign
R5412:Megf10 UTSW 18 57191147 missense probably damaging 0.99
R5901:Megf10 UTSW 18 57277108 missense probably benign 0.11
R6015:Megf10 UTSW 18 57253028 missense probably benign 0.01
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6036:Megf10 UTSW 18 57242727 missense probably damaging 1.00
R6041:Megf10 UTSW 18 57180549 missense probably benign
R6369:Megf10 UTSW 18 57261187 missense probably benign 0.06
R6479:Megf10 UTSW 18 57246570 missense possibly damaging 0.76
R6489:Megf10 UTSW 18 57291807 missense probably benign 0.01
R7228:Megf10 UTSW 18 57189589 missense probably damaging 1.00
R7296:Megf10 UTSW 18 57275753 missense probably damaging 1.00
R7437:Megf10 UTSW 18 57262131 missense probably damaging 1.00
R7461:Megf10 UTSW 18 57252853 missense probably damaging 0.98
R7488:Megf10 UTSW 18 57191115 missense probably damaging 0.99
R7492:Megf10 UTSW 18 57291794 missense probably benign 0.00
R7542:Megf10 UTSW 18 57189570 missense probably benign 0.07
R7636:Megf10 UTSW 18 57276989 missense possibly damaging 0.85
R7646:Megf10 UTSW 18 57293999 unclassified probably benign
R7650:Megf10 UTSW 18 57293999 unclassified probably benign
R7713:Megf10 UTSW 18 57293999 unclassified probably benign
R7714:Megf10 UTSW 18 57293999 unclassified probably benign
R7796:Megf10 UTSW 18 57277659 missense possibly damaging 0.85
R7915:Megf10 UTSW 18 57240735 missense probably benign 0.05
R8221:Megf10 UTSW 18 57283821 missense probably benign 0.00
RF003:Megf10 UTSW 18 57294027 unclassified probably benign
Z1176:Megf10 UTSW 18 57277694 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GTTCCTGGTTATTACAGAACCTACAG -3'
(R):5'- TTCCAAACCCTGTGTTCACAAC -3'

Sequencing Primer
(F):5'- AACCTACAGTGAGCGTTGTGC -3'
(R):5'- TGTTCACAACACACCTCGATGG -3'
Posted On2019-11-12