Incidental Mutation 'R7717:Cxcr2'
ID 594960
Institutional Source Beutler Lab
Gene Symbol Cxcr2
Ensembl Gene ENSMUSG00000026180
Gene Name chemokine (C-X-C motif) receptor 2
Synonyms CD128, IL-8rb, Cmkar2, IL8RA, Il8rb, IL-8Rh, Gpcr16
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 74153989-74161246 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 74158839 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000102512 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027372] [ENSMUST00000106899]
AlphaFold P35343
Predicted Effect probably benign
Transcript: ENSMUST00000027372
AA Change: V164A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027372
Gene: ENSMUSG00000026180
AA Change: V164A

DomainStartEndE-ValueType
Pfam:7tm_1 64 313 1.2e-53 PFAM
low complexity region 346 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106899
AA Change: V164A

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000102512
Gene: ENSMUSG00000026180
AA Change: V164A

DomainStartEndE-ValueType
Pfam:7tm_1 64 313 1.1e-58 PFAM
low complexity region 346 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein-coupled receptor family. This protein is a receptor for interleukin 8 (IL8). It binds to IL8 with high affinity, and transduces the signal through a G-protein activated second messenger system. This receptor also binds to chemokine (C-X-C motif) ligand 1 (CXCL1/MGSA), a protein with melanoma growth stimulating activity, and has been shown to be a major component required for serum-dependent melanoma cell growth. This receptor mediates neutrophil migration to sites of inflammation. The angiogenic effects of IL8 in intestinal microvascular endothelial cells are found to be mediated by this receptor. Knockout studies in mice suggested that this receptor controls the positioning of oligodendrocyte precursors in developing spinal cord by arresting their migration. This gene, IL8RA, a gene encoding another high affinity IL8 receptor, as well as IL8RBP, a pseudogene of IL8RB, form a gene cluster in a region mapped to chromosome 2q33-q36. Alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit splenomegaly, lymphadenopathy, and increased susceptibility to various pathogens due to impaired neutrophil recruitment and decreased pathogen clearance during innate immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Cxcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02128:Cxcr2 APN 1 74158994 missense probably benign 0.07
IGL03384:Cxcr2 APN 1 74158791 missense probably damaging 0.98
copperas UTSW 1 74158460 missense probably damaging 0.98
R0780:Cxcr2 UTSW 1 74159175 missense probably damaging 0.97
R1178:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1180:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1448:Cxcr2 UTSW 1 74158368 missense probably benign 0.04
R1535:Cxcr2 UTSW 1 74159058 missense probably damaging 1.00
R1851:Cxcr2 UTSW 1 74159279 missense probably benign 0.01
R1852:Cxcr2 UTSW 1 74159279 missense probably benign 0.01
R2897:Cxcr2 UTSW 1 74158971 missense probably benign 0.04
R2898:Cxcr2 UTSW 1 74158971 missense probably benign 0.04
R4430:Cxcr2 UTSW 1 74158845 missense probably benign 0.01
R4542:Cxcr2 UTSW 1 74158529 missense probably benign 0.02
R5625:Cxcr2 UTSW 1 74158832 nonsense probably null
R5996:Cxcr2 UTSW 1 74158460 missense probably damaging 0.98
R6737:Cxcr2 UTSW 1 74158631 missense probably benign
R7206:Cxcr2 UTSW 1 74159054 missense possibly damaging 0.69
R7577:Cxcr2 UTSW 1 74158915 missense probably benign 0.00
R7873:Cxcr2 UTSW 1 74159007 missense probably benign 0.14
R8300:Cxcr2 UTSW 1 74159174 missense probably benign 0.01
R9224:Cxcr2 UTSW 1 74158597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCATTGCTGACCTGTTC -3'
(R):5'- TGAACCCGTAGCAGAACAGC -3'

Sequencing Primer
(F):5'- CCTGTCTGGGCTGCATCTAAAG -3'
(R):5'- CCCGTAGCAGAACAGCATGATG -3'
Posted On 2019-11-12