Incidental Mutation 'R7717:Larp1b'
ID594962
Institutional Source Beutler Lab
Gene Symbol Larp1b
Ensembl Gene ENSMUSG00000025762
Gene NameLa ribonucleoprotein domain family, member 1B
SynonymsLarp2, 1700108L22Rik, 4933421B21Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7717 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location40950354-41040234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 40972444 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 251 (S251F)
Ref Sequence ENSEMBL: ENSMUSP00000037127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048490] [ENSMUST00000191805] [ENSMUST00000191872]
Predicted Effect probably damaging
Transcript: ENSMUST00000048490
AA Change: S251F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000037127
Gene: ENSMUSG00000025762
AA Change: S251F

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
low complexity region 138 164 N/A INTRINSIC
LA 213 291 4.35e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191805
AA Change: S251F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141487
Gene: ENSMUSG00000025762
AA Change: S251F

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 122 133 N/A INTRINSIC
low complexity region 138 164 N/A INTRINSIC
LA 213 291 4.35e-37 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000191872
AA Change: S204F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142106
Gene: ENSMUSG00000025762
AA Change: S204F

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 70 86 N/A INTRINSIC
low complexity region 91 117 N/A INTRINSIC
LA 166 244 4.35e-37 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Larp1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Larp1b APN 3 41033440 nonsense probably null
IGL01636:Larp1b APN 3 40970478 missense probably benign 0.35
IGL01845:Larp1b APN 3 40970525 missense probably benign 0.03
IGL02192:Larp1b APN 3 40967494 missense probably benign 0.01
IGL03372:Larp1b APN 3 41024527 missense possibly damaging 0.79
R0396:Larp1b UTSW 3 40970561 missense probably damaging 1.00
R0512:Larp1b UTSW 3 40970034 missense probably benign 0.00
R0975:Larp1b UTSW 3 40970490 missense probably damaging 0.99
R1119:Larp1b UTSW 3 41033528 missense possibly damaging 0.87
R1337:Larp1b UTSW 3 41033402 missense probably damaging 1.00
R1460:Larp1b UTSW 3 40962218 missense probably benign
R1565:Larp1b UTSW 3 40972384 missense probably damaging 1.00
R1589:Larp1b UTSW 3 41033474 missense probably damaging 1.00
R1640:Larp1b UTSW 3 41034072 start codon destroyed probably null 0.04
R1899:Larp1b UTSW 3 40964084 missense probably benign 0.04
R2133:Larp1b UTSW 3 40970535 missense possibly damaging 0.69
R3054:Larp1b UTSW 3 40964100 missense probably benign 0.10
R4621:Larp1b UTSW 3 40963989 missense possibly damaging 0.71
R4818:Larp1b UTSW 3 40970570 missense probably damaging 1.00
R5023:Larp1b UTSW 3 41033985 missense possibly damaging 0.88
R5166:Larp1b UTSW 3 40964052 nonsense probably null
R5357:Larp1b UTSW 3 41024515 missense probably benign 0.04
R5364:Larp1b UTSW 3 40977223 missense probably damaging 0.99
R5492:Larp1b UTSW 3 40969899 missense probably damaging 0.99
R5495:Larp1b UTSW 3 41035822 missense probably damaging 1.00
R7070:Larp1b UTSW 3 40976651 missense probably damaging 1.00
R7293:Larp1b UTSW 3 40985444 missense
R7615:Larp1b UTSW 3 41033534 missense possibly damaging 0.79
R7615:Larp1b UTSW 3 41035816 missense probably benign 0.01
R8060:Larp1b UTSW 3 40985402 missense
R8282:Larp1b UTSW 3 41036810 missense probably damaging 0.99
R8429:Larp1b UTSW 3 40977227 makesense probably null
R8458:Larp1b UTSW 3 40976560 missense probably benign 0.00
X0021:Larp1b UTSW 3 40967494 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGTGCCATGTTATAGTCCATG -3'
(R):5'- GGTGATAAACCCAGGATCTTGTG -3'

Sequencing Primer
(F):5'- GGATGAACTCATGTCCTCT -3'
(R):5'- GTGTATATATACCAATGCTCTGCTC -3'
Posted On2019-11-12