Incidental Mutation 'R7717:Vmn2r2'
ID594963
Institutional Source Beutler Lab
Gene Symbol Vmn2r2
Ensembl Gene ENSMUSG00000043897
Gene Namevomeronasal 2, receptor 2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R7717 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location64116432-64140543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64134598 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 232 (V232A)
Ref Sequence ENSEMBL: ENSMUSP00000135110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077958] [ENSMUST00000177151]
Predicted Effect possibly damaging
Transcript: ENSMUST00000077958
AA Change: V148A

PolyPhen 2 Score 0.843 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077109
Gene: ENSMUSG00000043897
AA Change: V148A

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 4.5e-80 PFAM
Pfam:NCD3G 458 511 8.3e-18 PFAM
Pfam:7tm_3 542 779 1.3e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000177151
AA Change: V232A

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135110
Gene: ENSMUSG00000043897
AA Change: V232A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 83 500 1.6e-84 PFAM
Pfam:NCD3G 542 595 2.6e-17 PFAM
Pfam:7tm_3 628 862 1.9e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Vmn2r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00326:Vmn2r2 APN 3 64133898 splice site probably benign
IGL00980:Vmn2r2 APN 3 64117180 missense probably benign 0.11
IGL01389:Vmn2r2 APN 3 64117009 missense probably damaging 0.97
IGL01804:Vmn2r2 APN 3 64134256 missense possibly damaging 0.91
IGL02750:Vmn2r2 APN 3 64117402 missense probably damaging 1.00
IGL02829:Vmn2r2 APN 3 64118751 splice site probably benign
IGL03036:Vmn2r2 APN 3 64116900 missense probably benign 0.01
IGL03174:Vmn2r2 APN 3 64117123 nonsense probably null
PIT4151001:Vmn2r2 UTSW 3 64116913 missense possibly damaging 0.67
R0029:Vmn2r2 UTSW 3 64116944 missense probably benign 0.00
R0310:Vmn2r2 UTSW 3 64134618 missense probably damaging 1.00
R0357:Vmn2r2 UTSW 3 64133899 splice site probably null
R0637:Vmn2r2 UTSW 3 64126578 missense probably benign 0.00
R1626:Vmn2r2 UTSW 3 64134500 missense possibly damaging 0.61
R1662:Vmn2r2 UTSW 3 64117130 missense probably benign 0.00
R1710:Vmn2r2 UTSW 3 64117399 missense probably benign 0.19
R1797:Vmn2r2 UTSW 3 64134707 missense probably benign 0.00
R1862:Vmn2r2 UTSW 3 64134521 missense possibly damaging 0.79
R1971:Vmn2r2 UTSW 3 64126700 missense probably damaging 1.00
R2051:Vmn2r2 UTSW 3 64117345 missense possibly damaging 0.77
R2099:Vmn2r2 UTSW 3 64117053 missense probably damaging 1.00
R2275:Vmn2r2 UTSW 3 64116509 missense probably benign 0.00
R3078:Vmn2r2 UTSW 3 64134632 missense probably benign 0.22
R3418:Vmn2r2 UTSW 3 64116899 missense probably benign 0.00
R3419:Vmn2r2 UTSW 3 64116899 missense probably benign 0.00
R3959:Vmn2r2 UTSW 3 64140526 missense probably benign
R4230:Vmn2r2 UTSW 3 64134491 missense probably benign 0.00
R4258:Vmn2r2 UTSW 3 64134697 missense probably damaging 1.00
R4810:Vmn2r2 UTSW 3 64137462 missense probably damaging 1.00
R4822:Vmn2r2 UTSW 3 64134539 missense probably damaging 0.99
R4919:Vmn2r2 UTSW 3 64117157 missense possibly damaging 0.56
R4925:Vmn2r2 UTSW 3 64137471 start codon destroyed probably null 0.03
R4954:Vmn2r2 UTSW 3 64140484 missense probably benign 0.00
R5071:Vmn2r2 UTSW 3 64116900 missense probably benign 0.01
R5315:Vmn2r2 UTSW 3 64116956 missense probably benign 0.37
R5450:Vmn2r2 UTSW 3 64126590 missense probably benign
R5577:Vmn2r2 UTSW 3 64116995 missense probably benign 0.00
R5595:Vmn2r2 UTSW 3 64126615 missense possibly damaging 0.74
R5727:Vmn2r2 UTSW 3 64117187 missense probably benign 0.41
R5810:Vmn2r2 UTSW 3 64117394 missense probably damaging 1.00
R5919:Vmn2r2 UTSW 3 64137302 missense probably benign 0.39
R6052:Vmn2r2 UTSW 3 64117361 missense possibly damaging 0.56
R6084:Vmn2r2 UTSW 3 64117046 missense probably benign 0.01
R6299:Vmn2r2 UTSW 3 64116653 nonsense probably null
R6762:Vmn2r2 UTSW 3 64134449 missense probably damaging 1.00
R6858:Vmn2r2 UTSW 3 64137494 missense probably damaging 1.00
R6889:Vmn2r2 UTSW 3 64117267 missense probably damaging 0.99
R6990:Vmn2r2 UTSW 3 64117187 missense probably benign 0.02
R7195:Vmn2r2 UTSW 3 64116479 missense probably benign 0.01
R7269:Vmn2r2 UTSW 3 64126577 missense probably benign 0.32
R7798:Vmn2r2 UTSW 3 64134097 missense possibly damaging 0.60
X0024:Vmn2r2 UTSW 3 64137286 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCTTCACTGGCTATCCATG -3'
(R):5'- GGGCTATACTTCTTCCTGTGCAG -3'

Sequencing Primer
(F):5'- TGATGAATCACTTCCAGCACAAATGG -3'
(R):5'- GTGCAGTTCTTAGTGACACATTCCAG -3'
Posted On2019-11-12