Incidental Mutation 'R7717:Lrp8'
ID 594964
Institutional Source Beutler Lab
Gene Symbol Lrp8
Ensembl Gene ENSMUSG00000028613
Gene Name low density lipoprotein receptor-related protein 8, apolipoprotein e receptor
Synonyms Lr8b, 4932703M08Rik, apoER2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 107802261-107876840 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 107834743 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 115 (T115A)
Ref Sequence ENSEMBL: ENSMUSP00000102343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030356] [ENSMUST00000106732] [ENSMUST00000106733] [ENSMUST00000126573] [ENSMUST00000143601]
AlphaFold Q924X6
Predicted Effect probably benign
Transcript: ENSMUST00000030356
AA Change: T115A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030356
Gene: ENSMUSG00000028613
AA Change: T115A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106731
AA Change: T44A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102342
Gene: ENSMUSG00000028613
AA Change: T44A

DomainStartEndE-ValueType
EGF_like 9 47 3.29e1 SMART
LDLa 9 48 2.45e-13 SMART
LDLa 50 89 1.19e-11 SMART
LDLa 93 130 4.58e-13 SMART
EGF 134 170 2.83e-5 SMART
EGF_CA 171 210 9.91e-10 SMART
LY 237 279 8.44e-4 SMART
LY 284 326 2.29e-14 SMART
LY 327 370 5.96e-13 SMART
LY 371 413 4.21e-13 SMART
LY 415 457 7.24e-3 SMART
EGF 484 530 1.56e1 SMART
low complexity region 532 548 N/A INTRINSIC
low complexity region 586 601 N/A INTRINSIC
transmembrane domain 621 643 N/A INTRINSIC
low complexity region 666 672 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106732
AA Change: T115A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000102343
Gene: ENSMUSG00000028613
AA Change: T115A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 164 201 4.58e-13 SMART
LDLa 204 244 1.4e-8 SMART
EGF 246 282 2.83e-5 SMART
EGF_CA 283 322 9.91e-10 SMART
LY 349 391 8.44e-4 SMART
LY 396 438 2.29e-14 SMART
LY 439 482 5.96e-13 SMART
LY 483 525 4.21e-13 SMART
LY 527 569 7.24e-3 SMART
EGF 596 642 1.56e1 SMART
low complexity region 644 660 N/A INTRINSIC
low complexity region 698 713 N/A INTRINSIC
transmembrane domain 733 755 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106733
AA Change: T115A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000102344
Gene: ENSMUSG00000028613
AA Change: T115A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
EGF 331 367 2.83e-5 SMART
EGF_CA 368 407 9.91e-10 SMART
LY 434 476 8.44e-4 SMART
LY 481 523 2.29e-14 SMART
LY 524 567 5.96e-13 SMART
LY 568 610 4.21e-13 SMART
LY 612 654 7.24e-3 SMART
EGF 681 727 1.56e1 SMART
low complexity region 729 745 N/A INTRINSIC
low complexity region 783 798 N/A INTRINSIC
transmembrane domain 818 840 N/A INTRINSIC
low complexity region 863 869 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126573
AA Change: T115A

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118020
Gene: ENSMUSG00000028613
AA Change: T115A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 163 200 4.58e-13 SMART
EGF 204 240 2.83e-5 SMART
EGF_CA 241 280 9.91e-10 SMART
LY 307 349 8.44e-4 SMART
LY 354 396 2.29e-14 SMART
LY 397 440 5.96e-13 SMART
LY 441 483 4.21e-13 SMART
LY 485 527 7.24e-3 SMART
EGF 554 600 1.56e1 SMART
transmembrane domain 616 638 N/A INTRINSIC
low complexity region 661 667 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143601
AA Change: T115A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000115854
Gene: ENSMUSG00000028613
AA Change: T115A

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LDLa 40 77 3.24e-13 SMART
EGF_like 79 117 3.29e1 SMART
LDLa 79 118 2.45e-13 SMART
LDLa 120 159 1.19e-11 SMART
LDLa 160 197 3.52e-14 SMART
LDLa 199 239 8.09e-14 SMART
LDLa 250 288 4.05e-14 SMART
LDLa 290 327 4.58e-13 SMART
LDLa 330 370 1.4e-8 SMART
EGF 372 408 2.83e-5 SMART
EGF_CA 409 448 9.91e-10 SMART
LY 475 517 8.44e-4 SMART
LY 522 564 2.29e-14 SMART
LY 565 608 5.96e-13 SMART
LY 609 651 4.21e-13 SMART
LY 653 695 7.24e-3 SMART
EGF 722 768 1.56e1 SMART
low complexity region 770 786 N/A INTRINSIC
low complexity region 824 839 N/A INTRINSIC
transmembrane domain 859 881 N/A INTRINSIC
low complexity region 904 910 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein receptor (LDLR) family. Low density lipoprotein receptors are cell surface proteins that play roles in both signal transduction and receptor-mediated endocytosis of specific ligands for lysosomal degradation. The encoded protein plays a critical role in the migration of neurons during development by mediating Reelin signaling, and also functions as a receptor for the cholesterol transport protein apolipoprotein E. Expression of this gene may be a marker for major depressive disorder. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit impaired granule cell migration, radial glial scaffold formation, contextual fear conditioning, and long-term potentiation. Mutant males have abnormal sperm and are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Lrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Lrp8 APN 4 107864076 missense probably benign 0.04
IGL01514:Lrp8 APN 4 107855684 missense probably damaging 1.00
IGL02058:Lrp8 APN 4 107870109 missense probably benign 0.25
IGL02398:Lrp8 APN 4 107847494 missense probably damaging 0.97
IGL02398:Lrp8 APN 4 107869048 missense probably damaging 1.00
IGL02706:Lrp8 APN 4 107803319 nonsense probably null
IGL02754:Lrp8 APN 4 107834755 splice site probably null
IGL02967:Lrp8 APN 4 107861234 missense probably benign 0.21
IGL03080:Lrp8 APN 4 107855799 missense probably damaging 1.00
IGL02837:Lrp8 UTSW 4 107861281 missense probably benign 0.01
R0312:Lrp8 UTSW 4 107806855 intron probably benign
R0440:Lrp8 UTSW 4 107869098 missense probably damaging 0.99
R0598:Lrp8 UTSW 4 107857237 missense possibly damaging 0.73
R1627:Lrp8 UTSW 4 107854416 missense probably damaging 0.99
R1967:Lrp8 UTSW 4 107859971 missense probably damaging 1.00
R2183:Lrp8 UTSW 4 107803265 missense probably damaging 1.00
R2208:Lrp8 UTSW 4 107855790 missense probably damaging 1.00
R2325:Lrp8 UTSW 4 107864009 missense probably benign 0.03
R3712:Lrp8 UTSW 4 107848302 missense probably benign 0.08
R4093:Lrp8 UTSW 4 107843271 nonsense probably null
R4706:Lrp8 UTSW 4 107861273 missense probably benign 0.00
R4765:Lrp8 UTSW 4 107854395 missense probably damaging 1.00
R4840:Lrp8 UTSW 4 107870037 missense possibly damaging 0.79
R4900:Lrp8 UTSW 4 107806809 intron probably benign
R5033:Lrp8 UTSW 4 107834755 splice site probably null
R5280:Lrp8 UTSW 4 107854321 missense probably damaging 1.00
R5381:Lrp8 UTSW 4 107869110 missense probably damaging 1.00
R5935:Lrp8 UTSW 4 107857296 missense probably damaging 1.00
R5972:Lrp8 UTSW 4 107869070 missense probably damaging 1.00
R6076:Lrp8 UTSW 4 107847459 missense possibly damaging 0.81
R6343:Lrp8 UTSW 4 107869156 splice site probably null
R6805:Lrp8 UTSW 4 107854320 missense probably damaging 0.99
R7100:Lrp8 UTSW 4 107802450 missense possibly damaging 0.93
R7262:Lrp8 UTSW 4 107847464 missense probably benign
R7949:Lrp8 UTSW 4 107803327 missense probably damaging 1.00
R8350:Lrp8 UTSW 4 107847464 missense probably benign
R8371:Lrp8 UTSW 4 107869071 missense probably damaging 1.00
R9272:Lrp8 UTSW 4 107859961 missense probably benign 0.19
Z1177:Lrp8 UTSW 4 107843332 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CTCTGTCTTAGAAAAGCATTCAGTGC -3'
(R):5'- TCTAATTCCTGGTGCTGCAGG -3'

Sequencing Primer
(F):5'- ATTCAGTGCTCACCCTTATGC -3'
(R):5'- ACCTACAGGGAAGCTCAGG -3'
Posted On 2019-11-12