Mutagenetix > Incidental Mutations

Incidental Mutation 'R7717:Csf3r'

594967

Institutional Source

Beutler Lab

Gene Symbol

Csf3r

Ensembl Gene

ENSMUSG00000028859

Gene Name

colony stimulating factor 3 receptor (granulocyte)

Synonyms

G-CSFR, Cd114, Csfgr

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.317) question?

Stock #

R7717 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

126024550-126044440 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126037610 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 462 (Y462C)

Ref Sequence

ENSEMBL: ENSMUSP00000101768 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030673] [ENSMUST00000106162]

AlphaFold

P40223

Predicted Effect

probably damaging
Transcript: ENSMUST00000030673
AA Change: Y462C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030673
Gene: ENSMUSG00000028859
AA Change: Y462C

Domain	Start	End	E-Value	Type
Pfam:Lep_receptor_Ig	24	111	2.3e-30	PFAM
FN3	124	213	5.38e1	SMART
SCOP:d1cd9b2	226	332	3e-15	SMART
Blast:FN3	334	420	3e-30	BLAST
FN3	432	518	2.41e0	SMART
FN3	530	612	1.92e-3	SMART
transmembrane domain	627	649	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000106162
AA Change: Y462C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101768
Gene: ENSMUSG00000028859
AA Change: Y462C

Domain	Start	End	E-Value	Type
Pfam:Lep_receptor_Ig	22	112	6.8e-30	PFAM
FN3	124	213	5.38e1	SMART
SCOP:d1cd9b2	226	332	3e-15	SMART
Blast:FN3	334	420	3e-30	BLAST
FN3	432	518	2.41e0	SMART
FN3	530	612	1.92e-3	SMART
transmembrane domain	627	649	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Alternatively spliced transcript variants have been described. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced numbers of peripheral neutrophils, with fewer hematopoietic progenitors in bone marrow and impaired expansion and terminal differentiation of progenitors into granulocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,606,757	C408G	probably benign	Het
Adgrf5	T	C	17: 43,450,753	L1113P	probably damaging	Het
Aldh3b3	T	C	19: 3,963,970	L57P	probably damaging	Het
Asb15	A	G	6: 24,559,252	D132G	probably benign	Het
Cep290	C	T	10: 100,492,681	R111W	probably benign	Het
Cfap44	A	G	16: 44,429,935	D792G	probably damaging	Het
Col20a1	C	T	2: 181,007,615	R1029W	probably damaging	Het
Cthrc1	T	C	15: 39,077,116	V38A	probably benign	Het
Cxcr2	T	C	1: 74,158,839	V164A	probably benign	Het
D230025D16Rik	C	A	8: 105,251,604	Q397K	probably benign	Het
Efr3b	A	G	12: 3,984,574	S199P	probably damaging	Het
Elavl4	A	G	4: 110,206,466	C342R	probably damaging	Het
Gemin5	A	T	11: 58,151,530		probably null	Het
Gm14190	A	T	11: 99,690,650	C31S	unknown	Het
Golt1b	T	A	6: 142,394,043	V78D	probably damaging	Het
Gsdmc3	T	A	15: 63,869,212	D29V	probably damaging	Het
Itih1	T	A	14: 30,931,185	D766V	probably damaging	Het
Larp1b	C	T	3: 40,972,444	S251F	probably damaging	Het
Lrp8	A	G	4: 107,834,743	T115A	probably benign	Het
Lrrc37a	A	G	11: 103,504,300	S100P	probably benign	Het
Lss	T	C	10: 76,545,452	V424A	possibly damaging	Het
Ltbp1	T	C	17: 75,290,078	V568A	possibly damaging	Het
Myo10	A	T	15: 25,731,970	T311S	probably benign	Het
Nsd3	T	C	8: 25,682,562	V779A	probably benign	Het
Olfr1335	A	T	4: 118,808,933	S310R	probably damaging	Het
Olfr138	C	A	17: 38,275,580	Q270K	probably damaging	Het
Olfr1444	A	T	19: 12,861,795	I7F	probably benign	Het
Olfr624	T	C	7: 103,670,945	T29A	probably benign	Het
Olfr698	A	G	7: 106,752,636	W251R	possibly damaging	Het
Olfr748	T	A	14: 50,710,762	L144Q	probably damaging	Het
Pak1	T	A	7: 97,886,348	D215E	probably benign	Het
Pde7b	A	G	10: 20,407,191	F355L	probably benign	Het
Pi4ka	A	G	16: 17,376,923	S204P		Het
Pirb	T	C	7: 3,717,783	K239E	not run	Het
Pirb	C	T	7: 3,717,801	G233R	not run	Het
Pnp	G	A	14: 50,951,003	M211I	probably benign	Het
Pot1a	A	T	6: 25,758,823	L319Q	probably benign	Het
Rspry1	G	T	8: 94,623,122	C46F	probably damaging	Het
Sec11c	C	T	18: 65,812,712	T82M	possibly damaging	Het
Secisbp2	T	C	13: 51,673,098	V414A	probably benign	Het
Tenm2	A	G	11: 36,864,935	F79L	probably damaging	Het
Vmn2r2	A	G	3: 64,134,598	V232A	possibly damaging	Het
Zbtb17	T	C	4: 141,466,083	S593P	probably damaging	Het
Zfp143	T	G	7: 110,086,220	C419G	possibly damaging	Het
Zfp804b	T	C	5: 6,771,293	N590S	possibly damaging	Het

Other mutations in Csf3r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02059:Csf3r	APN	4	126032127	nonsense	probably null
IGL02224:Csf3r	APN	4	126043539	missense	probably benign	0.36
IGL02558:Csf3r	APN	4	126038135	splice site	probably benign
R0026:Csf3r	UTSW	4	126031884	missense	probably benign	0.33
R0033:Csf3r	UTSW	4	126031884	missense	probably benign	0.33
R0033:Csf3r	UTSW	4	126031884	missense	probably benign	0.33
R0121:Csf3r	UTSW	4	126029849	missense	probably benign	0.01
R0413:Csf3r	UTSW	4	126039667	splice site	probably benign
R0456:Csf3r	UTSW	4	126035861	missense	probably damaging	0.98
R0479:Csf3r	UTSW	4	126043823	missense	probably damaging	0.98
R1052:Csf3r	UTSW	4	126042988	splice site	probably null
R1466:Csf3r	UTSW	4	126031932	splice site	probably benign
R1512:Csf3r	UTSW	4	126029984	missense	possibly damaging	0.75
R1902:Csf3r	UTSW	4	126042918	missense	probably damaging	1.00
R1905:Csf3r	UTSW	4	126042745	missense	probably benign	0.12
R2520:Csf3r	UTSW	4	126035352	missense	probably benign	0.06
R3424:Csf3r	UTSW	4	126043756	missense	probably damaging	1.00
R3705:Csf3r	UTSW	4	126032285	missense	possibly damaging	0.76
R3907:Csf3r	UTSW	4	126034447	missense	probably benign	0.00
R4514:Csf3r	UTSW	4	126039860	missense	possibly damaging	0.61
R4817:Csf3r	UTSW	4	126037656	nonsense	probably null
R5111:Csf3r	UTSW	4	126030068	splice site	probably null
R5120:Csf3r	UTSW	4	126035827	missense	probably benign	0.00
R5308:Csf3r	UTSW	4	126035344	missense	probably benign	0.00
R5912:Csf3r	UTSW	4	126029960	missense	probably damaging	1.00
R6018:Csf3r	UTSW	4	126043621	missense	probably benign	0.01
R6024:Csf3r	UTSW	4	126037517	splice site	probably null
R7144:Csf3r	UTSW	4	126043722	missense	probably benign	0.03
R7615:Csf3r	UTSW	4	126037656	nonsense	probably null
R8443:Csf3r	UTSW	4	126029919	missense	possibly damaging	0.77
R8935:Csf3r	UTSW	4	126043407	missense	probably benign	0.00
R9131:Csf3r	UTSW	4	126030020	missense	probably benign
R9383:Csf3r	UTSW	4	126043446	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- TGGTATGACTGTTGAAGAACTCGG -3'
(R):5'- GCTACCTCTAGACATGCACC -3'

Sequencing Primer
(F):5'- GGTATTGACATACCCTGGATCACAG -3'
(R):5'- TCTAGACATGCACCCCTCC -3'

Posted On

2019-11-12