Incidental Mutation 'R7717:Csf3r'
ID 594967
Institutional Source Beutler Lab
Gene Symbol Csf3r
Ensembl Gene ENSMUSG00000028859
Gene Name colony stimulating factor 3 receptor (granulocyte)
Synonyms G-CSFR, Cd114, Csfgr
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 126024550-126044440 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126037610 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 462 (Y462C)
Ref Sequence ENSEMBL: ENSMUSP00000101768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030673] [ENSMUST00000106162]
AlphaFold P40223
Predicted Effect probably damaging
Transcript: ENSMUST00000030673
AA Change: Y462C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030673
Gene: ENSMUSG00000028859
AA Change: Y462C

DomainStartEndE-ValueType
Pfam:Lep_receptor_Ig 24 111 2.3e-30 PFAM
FN3 124 213 5.38e1 SMART
SCOP:d1cd9b2 226 332 3e-15 SMART
Blast:FN3 334 420 3e-30 BLAST
FN3 432 518 2.41e0 SMART
FN3 530 612 1.92e-3 SMART
transmembrane domain 627 649 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106162
AA Change: Y462C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101768
Gene: ENSMUSG00000028859
AA Change: Y462C

DomainStartEndE-ValueType
Pfam:Lep_receptor_Ig 22 112 6.8e-30 PFAM
FN3 124 213 5.38e1 SMART
SCOP:d1cd9b2 226 332 3e-15 SMART
Blast:FN3 334 420 3e-30 BLAST
FN3 432 518 2.41e0 SMART
FN3 530 612 1.92e-3 SMART
transmembrane domain 627 649 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Alternatively spliced transcript variants have been described. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced numbers of peripheral neutrophils, with fewer hematopoietic progenitors in bone marrow and impaired expansion and terminal differentiation of progenitors into granulocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Csf3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Csf3r APN 4 126032127 nonsense probably null
IGL02224:Csf3r APN 4 126043539 missense probably benign 0.36
IGL02558:Csf3r APN 4 126038135 splice site probably benign
R0026:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0033:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0033:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0121:Csf3r UTSW 4 126029849 missense probably benign 0.01
R0413:Csf3r UTSW 4 126039667 splice site probably benign
R0456:Csf3r UTSW 4 126035861 missense probably damaging 0.98
R0479:Csf3r UTSW 4 126043823 missense probably damaging 0.98
R1052:Csf3r UTSW 4 126042988 splice site probably null
R1466:Csf3r UTSW 4 126031932 splice site probably benign
R1512:Csf3r UTSW 4 126029984 missense possibly damaging 0.75
R1902:Csf3r UTSW 4 126042918 missense probably damaging 1.00
R1905:Csf3r UTSW 4 126042745 missense probably benign 0.12
R2520:Csf3r UTSW 4 126035352 missense probably benign 0.06
R3424:Csf3r UTSW 4 126043756 missense probably damaging 1.00
R3705:Csf3r UTSW 4 126032285 missense possibly damaging 0.76
R3907:Csf3r UTSW 4 126034447 missense probably benign 0.00
R4514:Csf3r UTSW 4 126039860 missense possibly damaging 0.61
R4817:Csf3r UTSW 4 126037656 nonsense probably null
R5111:Csf3r UTSW 4 126030068 splice site probably null
R5120:Csf3r UTSW 4 126035827 missense probably benign 0.00
R5308:Csf3r UTSW 4 126035344 missense probably benign 0.00
R5912:Csf3r UTSW 4 126029960 missense probably damaging 1.00
R6018:Csf3r UTSW 4 126043621 missense probably benign 0.01
R6024:Csf3r UTSW 4 126037517 splice site probably null
R7144:Csf3r UTSW 4 126043722 missense probably benign 0.03
R7615:Csf3r UTSW 4 126037656 nonsense probably null
R8443:Csf3r UTSW 4 126029919 missense possibly damaging 0.77
R8935:Csf3r UTSW 4 126043407 missense probably benign 0.00
R9131:Csf3r UTSW 4 126030020 missense probably benign
R9383:Csf3r UTSW 4 126043446 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGGTATGACTGTTGAAGAACTCGG -3'
(R):5'- GCTACCTCTAGACATGCACC -3'

Sequencing Primer
(F):5'- GGTATTGACATACCCTGGATCACAG -3'
(R):5'- TCTAGACATGCACCCCTCC -3'
Posted On 2019-11-12