Incidental Mutation 'R7717:Asb15'
ID594970
Institutional Source Beutler Lab
Gene Symbol Asb15
Ensembl Gene ENSMUSG00000029685
Gene Nameankyrin repeat and SOCS box-containing 15
Synonyms4930400E23Rik
Accession Numbers

Genbank: NM_080847; MGI: 1926160

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7717 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location24528144-24573164 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24559252 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 132 (D132G)
Ref Sequence ENSEMBL: ENSMUSP00000031696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031696] [ENSMUST00000117688]
Predicted Effect probably benign
Transcript: ENSMUST00000031696
AA Change: D132G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031696
Gene: ENSMUSG00000029685
AA Change: D132G

DomainStartEndE-ValueType
ANK 110 139 1.59e-3 SMART
ANK 143 172 2.97e-3 SMART
ANK 176 205 1.93e-2 SMART
ANK 209 238 2.1e-3 SMART
ANK 242 273 5.01e-1 SMART
ANK 275 304 2.63e2 SMART
ANK 307 336 1.99e-4 SMART
ANK 349 378 5.24e-4 SMART
ANK 379 408 1.27e-2 SMART
ANK 417 444 2.35e3 SMART
SOCS_box 534 576 2.34e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117688
AA Change: D132G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112965
Gene: ENSMUSG00000029685
AA Change: D132G

DomainStartEndE-ValueType
ANK 110 139 1.59e-3 SMART
ANK 143 172 2.97e-3 SMART
ANK 176 205 1.93e-2 SMART
ANK 209 238 2.1e-3 SMART
ANK 242 273 5.01e-1 SMART
ANK 275 304 2.63e2 SMART
ANK 307 336 1.99e-4 SMART
ANK 349 378 5.24e-4 SMART
ANK 379 408 1.27e-2 SMART
ANK 417 444 2.35e3 SMART
SOCS_box 534 576 2.34e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of cytokine signaling box superfamily. The proteins in this superfamily participate in the ubiquitin-proteasome system for the degradation of proteins in the cell cycle and signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Asb15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Asb15 APN 6 24558643 splice site probably benign
IGL00557:Asb15 APN 6 24558650 missense probably benign
IGL00694:Asb15 APN 6 24570664 missense possibly damaging 0.79
IGL01137:Asb15 APN 6 24556522 missense probably benign
IGL01681:Asb15 APN 6 24567138 missense probably damaging 0.98
IGL01691:Asb15 APN 6 24567272 missense probably benign 0.02
IGL01791:Asb15 APN 6 24567212 missense probably damaging 1.00
IGL01989:Asb15 APN 6 24565944 missense probably damaging 1.00
IGL02480:Asb15 APN 6 24570746 missense probably damaging 0.99
IGL02541:Asb15 APN 6 24566266 missense probably damaging 1.00
IGL02707:Asb15 APN 6 24558788 splice site probably benign
IGL03090:Asb15 APN 6 24567186 missense possibly damaging 0.52
IGL03331:Asb15 APN 6 24556524 missense possibly damaging 0.70
3-1:Asb15 UTSW 6 24566221 missense probably benign 0.00
R0196:Asb15 UTSW 6 24564393 missense probably damaging 0.99
R0603:Asb15 UTSW 6 24556557 missense probably damaging 1.00
R0650:Asb15 UTSW 6 24566164 missense probably damaging 1.00
R1114:Asb15 UTSW 6 24567177 missense probably damaging 1.00
R1170:Asb15 UTSW 6 24562487 splice site probably benign
R1365:Asb15 UTSW 6 24567270 missense possibly damaging 0.95
R2323:Asb15 UTSW 6 24556601 missense probably benign 0.01
R3147:Asb15 UTSW 6 24566259 missense probably damaging 1.00
R3148:Asb15 UTSW 6 24566259 missense probably damaging 1.00
R4762:Asb15 UTSW 6 24567237 missense possibly damaging 0.81
R4771:Asb15 UTSW 6 24570622 missense probably damaging 0.99
R4915:Asb15 UTSW 6 24566293 missense probably damaging 0.96
R5369:Asb15 UTSW 6 24562564 missense probably benign 0.00
R5415:Asb15 UTSW 6 24570691 missense probably benign 0.05
R5781:Asb15 UTSW 6 24564378 missense probably benign 0.11
R6649:Asb15 UTSW 6 24562633 missense probably benign
R6653:Asb15 UTSW 6 24562633 missense probably benign
R6781:Asb15 UTSW 6 24558675 missense probably benign
R6984:Asb15 UTSW 6 24566337 missense probably benign 0.17
R7297:Asb15 UTSW 6 24566463 missense probably damaging 0.96
R7340:Asb15 UTSW 6 24558514 missense probably benign 0.00
R7419:Asb15 UTSW 6 24556556 missense probably benign 0.08
R7549:Asb15 UTSW 6 24559030 intron probably null
R7662:Asb15 UTSW 6 24566090 missense probably benign 0.08
R7767:Asb15 UTSW 6 24559282 missense probably benign
R7781:Asb15 UTSW 6 24562645 missense probably benign 0.01
R7797:Asb15 UTSW 6 24562506 missense probably damaging 0.98
R7847:Asb15 UTSW 6 24564267 missense probably damaging 1.00
R7930:Asb15 UTSW 6 24564267 missense probably damaging 1.00
R8055:Asb15 UTSW 6 24556566 missense probably benign 0.05
Z1176:Asb15 UTSW 6 24566331 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGGCTGGTAGAAAGTGAC -3'
(R):5'- TCACGGGCAGGTGAAATATG -3'

Sequencing Primer
(F):5'- CCATGTGTGATTGACAAAAGTGTGTC -3'
(R):5'- CAGGTGAAATATGGCTGGGAGC -3'
Posted On2019-11-12