Mutagenetix > Incidental Mutation

Incidental Mutation 'R7717:Asb15'

594970

Institutional Source

Beutler Lab

Gene Symbol

Asb15

Ensembl Gene

ENSMUSG00000029685

Gene Name

ankyrin repeat and SOCS box-containing 15

Synonyms

4930400E23Rik

Accession Numbers

Genbank: NM_080847; MGI: 1926160

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7717 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

24528144-24573164 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 24559252 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 132 (D132G)

Ref Sequence

ENSEMBL: ENSMUSP00000031696 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031696] [ENSMUST00000117688]

AlphaFold

Q8VHS6

Predicted Effect

probably benign
Transcript: ENSMUST00000031696
AA Change: D132G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000031696
Gene: ENSMUSG00000029685
AA Change: D132G

Domain	Start	End	E-Value	Type
ANK	110	139	1.59e-3	SMART
ANK	143	172	2.97e-3	SMART
ANK	176	205	1.93e-2	SMART
ANK	209	238	2.1e-3	SMART
ANK	242	273	5.01e-1	SMART
ANK	275	304	2.63e2	SMART
ANK	307	336	1.99e-4	SMART
ANK	349	378	5.24e-4	SMART
ANK	379	408	1.27e-2	SMART
ANK	417	444	2.35e3	SMART
SOCS_box	534	576	2.34e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117688
AA Change: D132G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112965
Gene: ENSMUSG00000029685
AA Change: D132G

Domain	Start	End	E-Value	Type
ANK	110	139	1.59e-3	SMART
ANK	143	172	2.97e-3	SMART
ANK	176	205	1.93e-2	SMART
ANK	209	238	2.1e-3	SMART
ANK	242	273	5.01e-1	SMART
ANK	275	304	2.63e2	SMART
ANK	307	336	1.99e-4	SMART
ANK	349	378	5.24e-4	SMART
ANK	379	408	1.27e-2	SMART
ANK	417	444	2.35e3	SMART
SOCS_box	534	576	2.34e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the suppressor of cytokine signaling box superfamily. The proteins in this superfamily participate in the ubiquitin-proteasome system for the degradation of proteins in the cell cycle and signal transduction pathways. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,606,757	C408G	probably benign	Het
Adgrf5	T	C	17: 43,450,753	L1113P	probably damaging	Het
Aldh3b3	T	C	19: 3,963,970	L57P	probably damaging	Het
Cep290	C	T	10: 100,492,681	R111W	probably benign	Het
Cfap44	A	G	16: 44,429,935	D792G	probably damaging	Het
Col20a1	C	T	2: 181,007,615	R1029W	probably damaging	Het
Csf3r	A	G	4: 126,037,610	Y462C	probably damaging	Het
Cthrc1	T	C	15: 39,077,116	V38A	probably benign	Het
Cxcr2	T	C	1: 74,158,839	V164A	probably benign	Het
D230025D16Rik	C	A	8: 105,251,604	Q397K	probably benign	Het
Efr3b	A	G	12: 3,984,574	S199P	probably damaging	Het
Elavl4	A	G	4: 110,206,466	C342R	probably damaging	Het
Gemin5	A	T	11: 58,151,530		probably null	Het
Gm14190	A	T	11: 99,690,650	C31S	unknown	Het
Golt1b	T	A	6: 142,394,043	V78D	probably damaging	Het
Gsdmc3	T	A	15: 63,869,212	D29V	probably damaging	Het
Itih1	T	A	14: 30,931,185	D766V	probably damaging	Het
Larp1b	C	T	3: 40,972,444	S251F	probably damaging	Het
Lrp8	A	G	4: 107,834,743	T115A	probably benign	Het
Lrrc37a	A	G	11: 103,504,300	S100P	probably benign	Het
Lss	T	C	10: 76,545,452	V424A	possibly damaging	Het
Ltbp1	T	C	17: 75,290,078	V568A	possibly damaging	Het
Myo10	A	T	15: 25,731,970	T311S	probably benign	Het
Nsd3	T	C	8: 25,682,562	V779A	probably benign	Het
Olfr1335	A	T	4: 118,808,933	S310R	probably damaging	Het
Olfr138	C	A	17: 38,275,580	Q270K	probably damaging	Het
Olfr1444	A	T	19: 12,861,795	I7F	probably benign	Het
Olfr624	T	C	7: 103,670,945	T29A	probably benign	Het
Olfr698	A	G	7: 106,752,636	W251R	possibly damaging	Het
Olfr748	T	A	14: 50,710,762	L144Q	probably damaging	Het
Pak1	T	A	7: 97,886,348	D215E	probably benign	Het
Pde7b	A	G	10: 20,407,191	F355L	probably benign	Het
Pi4ka	A	G	16: 17,376,923	S204P		Het
Pirb	T	C	7: 3,717,783	K239E	not run	Het
Pirb	C	T	7: 3,717,801	G233R	not run	Het
Pnp	G	A	14: 50,951,003	M211I	probably benign	Het
Pot1a	A	T	6: 25,758,823	L319Q	probably benign	Het
Rspry1	G	T	8: 94,623,122	C46F	probably damaging	Het
Sec11c	C	T	18: 65,812,712	T82M	possibly damaging	Het
Secisbp2	T	C	13: 51,673,098	V414A	probably benign	Het
Tenm2	A	G	11: 36,864,935	F79L	probably damaging	Het
Vmn2r2	A	G	3: 64,134,598	V232A	possibly damaging	Het
Zbtb17	T	C	4: 141,466,083	S593P	probably damaging	Het
Zfp143	T	G	7: 110,086,220	C419G	possibly damaging	Het
Zfp804b	T	C	5: 6,771,293	N590S	possibly damaging	Het

Other mutations in Asb15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Asb15	APN	6	24558643	splice site	probably benign
IGL00557:Asb15	APN	6	24558650	missense	probably benign
IGL00694:Asb15	APN	6	24570664	missense	possibly damaging	0.79
IGL01137:Asb15	APN	6	24556522	missense	probably benign
IGL01681:Asb15	APN	6	24567138	missense	probably damaging	0.98
IGL01691:Asb15	APN	6	24567272	missense	probably benign	0.02
IGL01791:Asb15	APN	6	24567212	missense	probably damaging	1.00
IGL01989:Asb15	APN	6	24565944	missense	probably damaging	1.00
IGL02480:Asb15	APN	6	24570746	missense	probably damaging	0.99
IGL02541:Asb15	APN	6	24566266	missense	probably damaging	1.00
IGL02707:Asb15	APN	6	24558788	splice site	probably benign
IGL03090:Asb15	APN	6	24567186	missense	possibly damaging	0.52
IGL03331:Asb15	APN	6	24556524	missense	possibly damaging	0.70
3-1:Asb15	UTSW	6	24566221	missense	probably benign	0.00
BB002:Asb15	UTSW	6	24562724	missense	probably benign	0.00
BB012:Asb15	UTSW	6	24562724	missense	probably benign	0.00
R0196:Asb15	UTSW	6	24564393	missense	probably damaging	0.99
R0603:Asb15	UTSW	6	24556557	missense	probably damaging	1.00
R0650:Asb15	UTSW	6	24566164	missense	probably damaging	1.00
R1114:Asb15	UTSW	6	24567177	missense	probably damaging	1.00
R1170:Asb15	UTSW	6	24562487	splice site	probably benign
R1365:Asb15	UTSW	6	24567270	missense	possibly damaging	0.95
R2323:Asb15	UTSW	6	24556601	missense	probably benign	0.01
R3147:Asb15	UTSW	6	24566259	missense	probably damaging	1.00
R3148:Asb15	UTSW	6	24566259	missense	probably damaging	1.00
R4762:Asb15	UTSW	6	24567237	missense	possibly damaging	0.81
R4771:Asb15	UTSW	6	24570622	missense	probably damaging	0.99
R4915:Asb15	UTSW	6	24566293	missense	probably damaging	0.96
R5369:Asb15	UTSW	6	24562564	missense	probably benign	0.00
R5415:Asb15	UTSW	6	24570691	missense	probably benign	0.05
R5781:Asb15	UTSW	6	24564378	missense	probably benign	0.11
R6649:Asb15	UTSW	6	24562633	missense	probably benign
R6653:Asb15	UTSW	6	24562633	missense	probably benign
R6781:Asb15	UTSW	6	24558675	missense	probably benign
R6984:Asb15	UTSW	6	24566337	missense	probably benign	0.17
R7297:Asb15	UTSW	6	24566463	missense	probably damaging	0.96
R7340:Asb15	UTSW	6	24558514	missense	probably benign	0.00
R7419:Asb15	UTSW	6	24556556	missense	probably benign	0.08
R7549:Asb15	UTSW	6	24559030	splice site	probably null
R7662:Asb15	UTSW	6	24566090	missense	probably benign	0.08
R7767:Asb15	UTSW	6	24559282	missense	probably benign
R7781:Asb15	UTSW	6	24562645	missense	probably benign	0.01
R7797:Asb15	UTSW	6	24562506	missense	probably damaging	0.98
R7847:Asb15	UTSW	6	24564267	missense	probably damaging	1.00
R7925:Asb15	UTSW	6	24562724	missense	probably benign	0.00
R8055:Asb15	UTSW	6	24556566	missense	probably benign	0.05
R8304:Asb15	UTSW	6	24559297	missense	possibly damaging	0.89
R8694:Asb15	UTSW	6	24570667	missense	probably benign	0.00
R9268:Asb15	UTSW	6	24566299	missense	probably benign
Z1176:Asb15	UTSW	6	24566331	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCAGGCTGGTAGAAAGTGAC -3'
(R):5'- TCACGGGCAGGTGAAATATG -3'

Sequencing Primer
(F):5'- CCATGTGTGATTGACAAAAGTGTGTC -3'
(R):5'- CAGGTGAAATATGGCTGGGAGC -3'

Posted On

2019-11-12