Incidental Mutation 'R7717:Golt1b'
ID594972
Institutional Source Beutler Lab
Gene Symbol Golt1b
Ensembl Gene ENSMUSG00000030245
Gene Namegolgi transport 1B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7717 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location142387221-142403858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 142394043 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 78 (V78D)
Ref Sequence ENSEMBL: ENSMUSP00000032372 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032372]
Predicted Effect probably damaging
Transcript: ENSMUST00000032372
AA Change: V78D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032372
Gene: ENSMUSG00000030245
AA Change: V78D

DomainStartEndE-ValueType
Pfam:Got1 17 113 2e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Golt1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1990:Golt1b UTSW 6 142392354 missense probably damaging 1.00
R2254:Golt1b UTSW 6 142396253 missense probably damaging 1.00
R6014:Golt1b UTSW 6 142396217 missense probably damaging 0.98
R7606:Golt1b UTSW 6 142392342 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAGTGCAGGGACTCATGAG -3'
(R):5'- GCGGTCATTCAGGAAAAGTC -3'

Sequencing Primer
(F):5'- GACTCTGGTATCTGTCACATCAGAG -3'
(R):5'- GGTCATTCAGGAAAAGTCTCCCAC -3'
Posted On2019-11-12