Incidental Mutation 'R7717:Pak1'
ID594975
Institutional Source Beutler Lab
Gene Symbol Pak1
Ensembl Gene ENSMUSG00000030774
Gene Namep21 (RAC1) activated kinase 1
SynonymsPaka, PAK-1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7717 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location97788541-97912381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 97886348 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 215 (D215E)
Ref Sequence ENSEMBL: ENSMUSP00000033040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033040] [ENSMUST00000156637] [ENSMUST00000206984]
Predicted Effect probably benign
Transcript: ENSMUST00000033040
AA Change: D215E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033040
Gene: ENSMUSG00000030774
AA Change: D215E

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
PBD 75 110 3.92e-16 SMART
low complexity region 168 191 N/A INTRINSIC
S_TKc 269 520 7.19e-98 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156637
SMART Domains Protein: ENSMUSP00000138684
Gene: ENSMUSG00000030774

DomainStartEndE-ValueType
low complexity region 39 51 N/A INTRINSIC
PBD 75 110 3.92e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206984
AA Change: D215E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a family member of serine/threonine p21-activating kinases, known as PAK proteins. These proteins are critical effectors that link RhoGTPases to cytoskeleton reorganization and nuclear signaling, and they serve as targets for the small GTP binding proteins Cdc42 and Rac. This specific family member regulates cell motility and morphology. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele display defects in allergen-induced mast cell migration and degranulation. Mice homozygous for a different knock-out allele exhibit reduced long term potentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Pak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Pak1 APN 7 97854568 missense probably benign 0.03
IGL01676:Pak1 APN 7 97883531 missense probably benign 0.00
IGL02058:Pak1 APN 7 97911115 missense probably damaging 1.00
IGL02557:Pak1 APN 7 97871587 missense probably benign 0.08
IGL02678:Pak1 APN 7 97894002 missense probably damaging 0.99
R1739:Pak1 UTSW 7 97904695 missense probably damaging 1.00
R1874:Pak1 UTSW 7 97871580 missense probably benign 0.23
R2057:Pak1 UTSW 7 97907797 splice site probably null
R2363:Pak1 UTSW 7 97886314 missense probably benign 0.01
R2420:Pak1 UTSW 7 97854479 missense probably benign 0.02
R2880:Pak1 UTSW 7 97904811 missense probably damaging 1.00
R3113:Pak1 UTSW 7 97866114 nonsense probably null
R3722:Pak1 UTSW 7 97854497 missense probably damaging 1.00
R4363:Pak1 UTSW 7 97883586 missense possibly damaging 0.49
R6021:Pak1 UTSW 7 97854463 missense probably damaging 1.00
R6459:Pak1 UTSW 7 97907881 missense probably benign 0.04
R6820:Pak1 UTSW 7 97886379 missense probably benign
R7336:Pak1 UTSW 7 97888972 missense probably benign 0.13
R8033:Pak1 UTSW 7 97886383 missense probably benign
X0027:Pak1 UTSW 7 97904752 missense probably damaging 0.99
Z1177:Pak1 UTSW 7 97865494 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTTTACCCAGGGCAAATGG -3'
(R):5'- TTAATCAGGCACAGACTAAGGG -3'

Sequencing Primer
(F):5'- GAACAGTGCAGATTTTGGCC -3'
(R):5'- GCACAGACTAAGGGAAGACTC -3'
Posted On2019-11-12