Incidental Mutation 'R7717:Olfr624'
ID 594976
Institutional Source Beutler Lab
Gene Symbol Olfr624
Ensembl Gene ENSMUSG00000045780
Gene Name olfactory receptor 624
Synonyms MOR4-2P, GA_x6K02T2PBJ9-6394126-6393197
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.211) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 103665461-103671191 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 103670945 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 29 (T29A)
Ref Sequence ENSEMBL: ENSMUSP00000049938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062144]
AlphaFold F8VQI7
Predicted Effect probably benign
Transcript: ENSMUST00000062144
AA Change: T29A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000049938
Gene: ENSMUSG00000045780
AA Change: T29A

DomainStartEndE-ValueType
Pfam:7tm_4 27 306 3.3e-138 PFAM
Pfam:7tm_1 37 288 1.8e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Olfr624
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Olfr624 APN 7 103670475 nonsense probably null
IGL02536:Olfr624 APN 7 103670957 missense possibly damaging 0.78
IGL02684:Olfr624 APN 7 103670384 missense probably benign 0.06
FR4548:Olfr624 UTSW 7 103670960 small insertion probably benign
FR4548:Olfr624 UTSW 7 103670967 nonsense probably null
FR4976:Olfr624 UTSW 7 103670966 small insertion probably benign
R0295:Olfr624 UTSW 7 103670311 missense probably damaging 1.00
R0518:Olfr624 UTSW 7 103670489 missense possibly damaging 0.56
R0521:Olfr624 UTSW 7 103670489 missense possibly damaging 0.56
R1352:Olfr624 UTSW 7 103670311 missense probably damaging 1.00
R1779:Olfr624 UTSW 7 103670638 missense probably benign 0.15
R1878:Olfr624 UTSW 7 103670182 missense probably damaging 1.00
R1965:Olfr624 UTSW 7 103670896 missense probably damaging 1.00
R2162:Olfr624 UTSW 7 103670872 missense possibly damaging 0.95
R2316:Olfr624 UTSW 7 103670467 missense probably damaging 0.97
R3792:Olfr624 UTSW 7 103670146 missense probably damaging 1.00
R3848:Olfr624 UTSW 7 103670701 missense probably damaging 0.99
R4120:Olfr624 UTSW 7 103671014 missense probably benign
R4183:Olfr624 UTSW 7 103670971 missense possibly damaging 0.87
R4853:Olfr624 UTSW 7 103670803 missense probably damaging 1.00
R6351:Olfr624 UTSW 7 103670956 missense possibly damaging 0.50
R9091:Olfr624 UTSW 7 103670917 missense probably damaging 1.00
R9270:Olfr624 UTSW 7 103670917 missense probably damaging 1.00
R9273:Olfr624 UTSW 7 103670426 missense probably benign 0.03
R9378:Olfr624 UTSW 7 103670182 missense probably damaging 1.00
X0026:Olfr624 UTSW 7 103670395 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGCAATGCAGGCATCAAGG -3'
(R):5'- CAAGGAACATGTCTCAGTTTCAC -3'

Sequencing Primer
(F):5'- GCATCAAGGCTGATCTCTTGAAG -3'
(R):5'- ACATGTCTCAGTTTCACTGTTTATGG -3'
Posted On 2019-11-12