Incidental Mutation 'R7717:Zfp143'
ID 594978
Institutional Source Beutler Lab
Gene Symbol Zfp143
Ensembl Gene ENSMUSG00000061079
Gene Name zinc finger protein 143
Synonyms D7Ertd805e, KRAB14, pHZ-1, Staf, Zfp79, Zfp80-rs1
Accession Numbers

NCBI RefSeq: NM_009281.3; MGI:1277969

Is this an essential gene? Probably essential (E-score: 0.947) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 110061217-110095394 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 110086220 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Glycine at position 419 (C419G)
Ref Sequence ENSEMBL: ENSMUSP00000081778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084727] [ENSMUST00000169638] [ENSMUST00000209505] [ENSMUST00000211798]
AlphaFold O70230
Predicted Effect possibly damaging
Transcript: ENSMUST00000084727
AA Change: C419G

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081778
Gene: ENSMUSG00000061079
AA Change: C419G

DomainStartEndE-ValueType
ZnF_C2H2 236 260 5.5e-3 SMART
ZnF_C2H2 266 290 6.42e-4 SMART
ZnF_C2H2 296 320 4.01e-5 SMART
ZnF_C2H2 326 350 1.38e-3 SMART
ZnF_C2H2 356 380 3.95e-4 SMART
ZnF_C2H2 386 410 2.4e-3 SMART
ZnF_C2H2 416 439 1.79e-2 SMART
low complexity region 443 457 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169638
AA Change: C391G

PolyPhen 2 Score 0.563 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000126015
Gene: ENSMUSG00000061079
AA Change: C391G

DomainStartEndE-ValueType
ZnF_C2H2 209 233 5.5e-3 SMART
ZnF_C2H2 239 263 6.42e-4 SMART
ZnF_C2H2 269 293 4.01e-5 SMART
ZnF_C2H2 299 323 1.38e-3 SMART
ZnF_C2H2 329 353 3.95e-4 SMART
ZnF_C2H2 359 383 2.4e-3 SMART
ZnF_C2H2 389 412 1.79e-2 SMART
low complexity region 416 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209505
AA Change: C418G

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000211798
AA Change: C418G

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype Strain: 2678408
PHENOTYPE: Homozygous disruption of this locus results in fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(86) : Targeted(2) Gene trapped(84)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Zfp143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Zfp143 APN 7 110091772 missense probably damaging 0.99
IGL01610:Zfp143 APN 7 110074126 nonsense probably null
IGL01678:Zfp143 APN 7 110080351 splice site probably benign
IGL01734:Zfp143 APN 7 110072209 splice site probably benign
IGL02505:Zfp143 APN 7 110091786 missense possibly damaging 0.54
IGL02577:Zfp143 APN 7 110091907 missense probably damaging 1.00
IGL03084:Zfp143 APN 7 110069611 splice site probably benign
H8786:Zfp143 UTSW 7 110094368 missense probably damaging 1.00
P0015:Zfp143 UTSW 7 110086111 critical splice acceptor site probably null
R0324:Zfp143 UTSW 7 110077147 missense possibly damaging 0.94
R0445:Zfp143 UTSW 7 110061117 unclassified probably benign
R0668:Zfp143 UTSW 7 110061274 unclassified probably benign
R1178:Zfp143 UTSW 7 110075721 splice site probably benign
R1587:Zfp143 UTSW 7 110074068 missense probably benign 0.06
R1992:Zfp143 UTSW 7 110061282 unclassified probably benign
R2110:Zfp143 UTSW 7 110086246 missense probably damaging 1.00
R2364:Zfp143 UTSW 7 110083242 missense probably damaging 0.97
R2417:Zfp143 UTSW 7 110069596 missense possibly damaging 0.73
R2899:Zfp143 UTSW 7 110072129 missense probably damaging 1.00
R3923:Zfp143 UTSW 7 110074191 missense probably damaging 1.00
R4117:Zfp143 UTSW 7 110091913 missense probably damaging 0.97
R4804:Zfp143 UTSW 7 110088769 missense probably damaging 1.00
R5048:Zfp143 UTSW 7 110074118 missense probably damaging 0.99
R5097:Zfp143 UTSW 7 110088791 missense probably damaging 1.00
R5239:Zfp143 UTSW 7 110094352 missense probably damaging 1.00
R5541:Zfp143 UTSW 7 110070480 missense probably benign 0.02
R5543:Zfp143 UTSW 7 110083315 nonsense probably null
R5630:Zfp143 UTSW 7 110088773 missense probably damaging 1.00
R5806:Zfp143 UTSW 7 110086235 nonsense probably null
R6334:Zfp143 UTSW 7 110086131 missense probably damaging 1.00
R6736:Zfp143 UTSW 7 110091814 missense probably damaging 1.00
R7201:Zfp143 UTSW 7 110093080 missense possibly damaging 0.74
R7448:Zfp143 UTSW 7 110070498 missense probably benign 0.00
R7635:Zfp143 UTSW 7 110088818 missense probably benign 0.37
R7943:Zfp143 UTSW 7 110072474 splice site probably null
R8191:Zfp143 UTSW 7 110077157 missense probably damaging 1.00
R8268:Zfp143 UTSW 7 110091784 missense probably benign 0.27
R8368:Zfp143 UTSW 7 110083248 missense probably damaging 0.96
R8724:Zfp143 UTSW 7 110081903 missense probably benign 0.00
R8935:Zfp143 UTSW 7 110070529 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTGTGGAGTAACTTTGTCTAC -3'
(R):5'- CTGGTGTCTTTCTGCAGCAC -3'

Sequencing Primer
(F):5'- CTGTGGAGTAACTTTGTCTACCTATG -3'
(R):5'- GCAGCACTTGTCATGACTATAC -3'
Posted On 2019-11-12