Incidental Mutation 'R7717:Rspry1'
ID 594980
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Name ring finger and SPRY domain containing 1
Synonyms 4930470D19Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 95328569-95386905 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 95349750 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 46 (C46F)
Ref Sequence ENSEMBL: ENSMUSP00000057275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000121101] [ENSMUST00000211983] [ENSMUST00000212729]
AlphaFold Q8BVR6
Predicted Effect probably damaging
Transcript: ENSMUST00000060389
AA Change: C46F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: C46F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121101
AA Change: C46F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112482
Gene: ENSMUSG00000050079
AA Change: C46F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211983
AA Change: C46F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000212729
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 T C 17: 43,761,644 (GRCm39) L1113P probably damaging Het
Aldh3b3 T C 19: 4,013,970 (GRCm39) L57P probably damaging Het
Asb15 A G 6: 24,559,251 (GRCm39) D132G probably benign Het
Cep290 C T 10: 100,328,543 (GRCm39) R111W probably benign Het
Cfap44 A G 16: 44,250,298 (GRCm39) D792G probably damaging Het
Col20a1 C T 2: 180,649,408 (GRCm39) R1029W probably damaging Het
Csf3r A G 4: 125,931,403 (GRCm39) Y462C probably damaging Het
Cthrc1 T C 15: 38,940,511 (GRCm39) V38A probably benign Het
Cxcr2 T C 1: 74,197,998 (GRCm39) V164A probably benign Het
Efr3b A G 12: 4,034,574 (GRCm39) S199P probably damaging Het
Elavl4 A G 4: 110,063,663 (GRCm39) C342R probably damaging Het
Gemin5 A T 11: 58,042,356 (GRCm39) probably null Het
Gm14190 A T 11: 99,581,476 (GRCm39) C31S unknown Het
Golt1b T A 6: 142,339,769 (GRCm39) V78D probably damaging Het
Gsdmc3 T A 15: 63,741,061 (GRCm39) D29V probably damaging Het
Itih1 T A 14: 30,653,142 (GRCm39) D766V probably damaging Het
Larp1b C T 3: 40,926,879 (GRCm39) S251F probably damaging Het
Lrp8 A G 4: 107,691,940 (GRCm39) T115A probably benign Het
Lrrc37a A G 11: 103,395,126 (GRCm39) S100P probably benign Het
Lss T C 10: 76,381,286 (GRCm39) V424A possibly damaging Het
Ltbp1 T C 17: 75,597,073 (GRCm39) V568A possibly damaging Het
Myo10 A T 15: 25,732,056 (GRCm39) T311S probably benign Het
Nsd3 T C 8: 26,172,578 (GRCm39) V779A probably benign Het
Or10ak12 A T 4: 118,666,130 (GRCm39) S310R probably damaging Het
Or11h23 T A 14: 50,948,219 (GRCm39) L144Q probably damaging Het
Or2ag16 A G 7: 106,351,843 (GRCm39) W251R possibly damaging Het
Or2n1e C A 17: 38,586,471 (GRCm39) Q270K probably damaging Het
Or51v8 T C 7: 103,320,152 (GRCm39) T29A probably benign Het
Or5b21 A T 19: 12,839,159 (GRCm39) I7F probably benign Het
Pak1 T A 7: 97,535,555 (GRCm39) D215E probably benign Het
Pde7b A G 10: 20,282,937 (GRCm39) F355L probably benign Het
Phaf1 C A 8: 105,978,236 (GRCm39) Q397K probably benign Het
Pi4ka A G 16: 17,194,787 (GRCm39) S204P Het
Pirb T C 7: 3,720,782 (GRCm39) K239E not run Het
Pirb C T 7: 3,720,800 (GRCm39) G233R not run Het
Pnp G A 14: 51,188,460 (GRCm39) M211I probably benign Het
Pot1a A T 6: 25,758,822 (GRCm39) L319Q probably benign Het
Sanbr A C 11: 23,556,757 (GRCm39) C408G probably benign Het
Sec11c C T 18: 65,945,783 (GRCm39) T82M possibly damaging Het
Secisbp2 T C 13: 51,827,134 (GRCm39) V414A probably benign Het
Tenm2 A G 11: 36,755,762 (GRCm39) F79L probably damaging Het
Vmn2r2 A G 3: 64,042,019 (GRCm39) V232A possibly damaging Het
Zbtb17 T C 4: 141,193,394 (GRCm39) S593P probably damaging Het
Zfp143 T G 7: 109,685,427 (GRCm39) C419G possibly damaging Het
Zfp804b T C 5: 6,821,293 (GRCm39) N590S possibly damaging Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 95,349,608 (GRCm39) intron probably benign
IGL00158:Rspry1 APN 8 95,349,614 (GRCm39) start codon destroyed probably null 0.89
IGL01141:Rspry1 APN 8 95,376,483 (GRCm39) missense probably benign 0.00
IGL01860:Rspry1 APN 8 95,376,444 (GRCm39) missense probably benign 0.00
IGL02174:Rspry1 APN 8 95,359,768 (GRCm39) missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 95,380,884 (GRCm39) missense probably benign 0.42
IGL02926:Rspry1 APN 8 95,376,439 (GRCm39) missense probably damaging 1.00
IGL03366:Rspry1 APN 8 95,376,962 (GRCm39) missense probably benign 0.00
R0570:Rspry1 UTSW 8 95,356,420 (GRCm39) missense probably damaging 1.00
R1833:Rspry1 UTSW 8 95,362,116 (GRCm39) missense probably damaging 1.00
R1988:Rspry1 UTSW 8 95,358,682 (GRCm39) critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 95,349,735 (GRCm39) missense probably damaging 1.00
R3623:Rspry1 UTSW 8 95,376,405 (GRCm39) missense probably damaging 1.00
R3624:Rspry1 UTSW 8 95,376,405 (GRCm39) missense probably damaging 1.00
R4275:Rspry1 UTSW 8 95,376,389 (GRCm39) missense probably benign 0.00
R4888:Rspry1 UTSW 8 95,385,417 (GRCm39) missense probably benign 0.19
R5026:Rspry1 UTSW 8 95,376,931 (GRCm39) missense probably damaging 1.00
R5310:Rspry1 UTSW 8 95,349,813 (GRCm39) missense probably benign
R5374:Rspry1 UTSW 8 95,380,892 (GRCm39) missense probably benign 0.38
R5374:Rspry1 UTSW 8 95,349,636 (GRCm39) missense probably benign 0.00
R5387:Rspry1 UTSW 8 95,364,914 (GRCm39) missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 95,363,388 (GRCm39) splice site probably null
R5631:Rspry1 UTSW 8 95,355,706 (GRCm39) start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 95,363,239 (GRCm39) splice site probably null
R6065:Rspry1 UTSW 8 95,349,615 (GRCm39) start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 95,385,378 (GRCm39) missense probably damaging 1.00
R6276:Rspry1 UTSW 8 95,349,886 (GRCm39) missense probably damaging 1.00
R6821:Rspry1 UTSW 8 95,362,059 (GRCm39) nonsense probably null
R7390:Rspry1 UTSW 8 95,349,813 (GRCm39) missense probably benign
R7460:Rspry1 UTSW 8 95,376,963 (GRCm39) missense probably benign 0.00
R7644:Rspry1 UTSW 8 95,385,396 (GRCm39) missense probably benign 0.00
R7768:Rspry1 UTSW 8 95,356,469 (GRCm39) missense probably damaging 1.00
R7940:Rspry1 UTSW 8 95,349,635 (GRCm39) missense probably benign 0.22
R7978:Rspry1 UTSW 8 95,349,753 (GRCm39) missense probably damaging 0.98
R8087:Rspry1 UTSW 8 95,380,925 (GRCm39) missense probably benign 0.04
R8174:Rspry1 UTSW 8 95,376,450 (GRCm39) missense probably damaging 0.97
R8326:Rspry1 UTSW 8 95,366,217 (GRCm39) missense probably damaging 1.00
R8676:Rspry1 UTSW 8 95,358,747 (GRCm39) missense probably benign 0.01
R8715:Rspry1 UTSW 8 95,349,888 (GRCm39) missense probably damaging 0.98
R8869:Rspry1 UTSW 8 95,359,780 (GRCm39) missense probably damaging 0.97
R9253:Rspry1 UTSW 8 95,349,621 (GRCm39) missense probably damaging 1.00
R9281:Rspry1 UTSW 8 95,363,259 (GRCm39) missense probably damaging 1.00
R9699:Rspry1 UTSW 8 95,380,857 (GRCm39) missense probably benign 0.01
X0010:Rspry1 UTSW 8 95,356,429 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GACCTTCTCCAGCATTCAGTTG -3'
(R):5'- GTATTACCGCCAGTGTGTCC -3'

Sequencing Primer
(F):5'- GAATAGAATGCAAGTTCAGTTCCAC -3'
(R):5'- GTGTCCAGCACTAACCCATC -3'
Posted On 2019-11-12