Incidental Mutation 'R7717:D230025D16Rik'
ID 594981
Institutional Source Beutler Lab
Gene Symbol D230025D16Rik
Ensembl Gene ENSMUSG00000031889
Gene Name RIKEN cDNA D230025D16 gene
Synonyms Lin10
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.260) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 105225145-105253053 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 105251604 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 397 (Q397K)
Ref Sequence ENSEMBL: ENSMUSP00000034361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034361] [ENSMUST00000093217] [ENSMUST00000124113] [ENSMUST00000136822] [ENSMUST00000141957] [ENSMUST00000161745]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000034361
AA Change: Q397K

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034361
Gene: ENSMUSG00000031889
AA Change: Q397K

DomainStartEndE-ValueType
Pfam:UPF0183 15 407 1.7e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093217
SMART Domains Protein: ENSMUSP00000133023
Gene: ENSMUSG00000069920

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Pfam:Galactosyl_T 132 331 1e-40 PFAM
Pfam:Fringe 212 335 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124113
SMART Domains Protein: ENSMUSP00000119743
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 120 1.9e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136822
SMART Domains Protein: ENSMUSP00000130840
Gene: ENSMUSG00000069920

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Pfam:Galactosyl_T 132 331 1e-40 PFAM
Pfam:Fringe 212 335 3.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141957
SMART Domains Protein: ENSMUSP00000119148
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 161 2.8e-65 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161745
SMART Domains Protein: ENSMUSP00000125145
Gene: ENSMUSG00000069920

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 72 88 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in D230025D16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:D230025D16Rik APN 8 105240001 missense probably damaging 0.99
IGL02058:D230025D16Rik APN 8 105239709 missense probably damaging 1.00
IGL02162:D230025D16Rik APN 8 105239973 splice site probably benign
IGL02264:D230025D16Rik APN 8 105234546 missense possibly damaging 0.67
IGL02512:D230025D16Rik APN 8 105234478 splice site probably benign
FR4340:D230025D16Rik UTSW 8 105241098 missense probably benign
FR4342:D230025D16Rik UTSW 8 105241098 missense probably benign
FR4589:D230025D16Rik UTSW 8 105241098 missense probably benign
R0564:D230025D16Rik UTSW 8 105239971 splice site probably benign
R1458:D230025D16Rik UTSW 8 105246556 critical splice donor site probably null
R1705:D230025D16Rik UTSW 8 105238472 splice site probably benign
R1860:D230025D16Rik UTSW 8 105240071 missense probably null 1.00
R1861:D230025D16Rik UTSW 8 105240071 missense probably null 1.00
R1893:D230025D16Rik UTSW 8 105246501 missense probably damaging 1.00
R1969:D230025D16Rik UTSW 8 105246500 missense possibly damaging 0.81
R2246:D230025D16Rik UTSW 8 105246500 missense possibly damaging 0.81
R3914:D230025D16Rik UTSW 8 105239983 missense probably benign 0.00
R4175:D230025D16Rik UTSW 8 105241131 missense probably benign 0.09
R4176:D230025D16Rik UTSW 8 105241131 missense probably benign 0.09
R4602:D230025D16Rik UTSW 8 105246888 missense possibly damaging 0.72
R5965:D230025D16Rik UTSW 8 105234539 missense probably damaging 1.00
R7787:D230025D16Rik UTSW 8 105231188 missense probably damaging 1.00
R7881:D230025D16Rik UTSW 8 105249452 missense probably benign 0.21
R8168:D230025D16Rik UTSW 8 105248769 missense probably benign 0.02
R8949:D230025D16Rik UTSW 8 105249443 missense probably benign
R9183:D230025D16Rik UTSW 8 105231208 missense probably benign 0.01
Z1088:D230025D16Rik UTSW 8 105231172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTTCAGCAGGCTTTCGTAG -3'
(R):5'- GCCAAGGTGTCCAAGCAAAC -3'

Sequencing Primer
(F):5'- AAAAGCCATGTGTCCTGTGAAC -3'
(R):5'- GGTGTCCAAGCAAACACACAGG -3'
Posted On 2019-11-12