Incidental Mutation 'R7717:Pde7b'
ID 594982
Institutional Source Beutler Lab
Gene Symbol Pde7b
Ensembl Gene ENSMUSG00000019990
Gene Name phosphodiesterase 7B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 20398004-20725078 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 20407191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 355 (F355L)
Ref Sequence ENSEMBL: ENSMUSP00000020165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020165] [ENSMUST00000164195] [ENSMUST00000169016] [ENSMUST00000169404] [ENSMUST00000170265]
AlphaFold Q9QXQ1
Predicted Effect probably benign
Transcript: ENSMUST00000020165
AA Change: F355L

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000020165
Gene: ENSMUSG00000019990
AA Change: F355L

DomainStartEndE-ValueType
HDc 170 337 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164195
AA Change: F407L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000126913
Gene: ENSMUSG00000019990
AA Change: F407L

DomainStartEndE-ValueType
HDc 222 389 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169016
SMART Domains Protein: ENSMUSP00000130596
Gene: ENSMUSG00000019990

DomainStartEndE-ValueType
low complexity region 103 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169404
AA Change: F407L

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132378
Gene: ENSMUSG00000019990
AA Change: F407L

DomainStartEndE-ValueType
HDc 222 389 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170265
AA Change: F368L

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000126324
Gene: ENSMUSG00000019990
AA Change: F368L

DomainStartEndE-ValueType
low complexity region 26 38 N/A INTRINSIC
HDc 183 350 9.04e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The 3',5'-cyclic nucleotides cAMP and cGMP function as second messengers in a wide variety of signal transduction pathways. 3',5'-cyclic nucleotide phosphodiesterases (PDEs) catalyze the hydrolysis of cAMP and cGMP to the corresponding 5'-monophosphates and provide a mechanism to downregulate cAMP and cGMP signaling. This gene encodes a cAMP-specific phosphodiesterase, a member of the cyclic nucleotide phosphodiesterase family.[provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Pde7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00901:Pde7b APN 10 20619129 critical splice donor site probably null
IGL01312:Pde7b APN 10 20436194 critical splice donor site probably null
IGL01728:Pde7b APN 10 20434464 critical splice donor site probably null
IGL01868:Pde7b APN 10 20407165 nonsense probably null
PIT4431001:Pde7b UTSW 10 20400545 missense possibly damaging 0.77
R0241:Pde7b UTSW 10 20436216 missense probably damaging 1.00
R0241:Pde7b UTSW 10 20436216 missense probably damaging 1.00
R0505:Pde7b UTSW 10 20438746 missense probably damaging 1.00
R1386:Pde7b UTSW 10 20418801 missense probably damaging 1.00
R1518:Pde7b UTSW 10 20548121 missense probably damaging 1.00
R1539:Pde7b UTSW 10 20479686 missense possibly damaging 0.75
R1547:Pde7b UTSW 10 20434594 missense probably damaging 1.00
R1571:Pde7b UTSW 10 20413090 missense probably benign 0.05
R1611:Pde7b UTSW 10 20434490 missense probably benign 0.14
R1722:Pde7b UTSW 10 20436244 missense probably damaging 1.00
R2275:Pde7b UTSW 10 20400419 makesense probably null
R4622:Pde7b UTSW 10 20418792 missense probably damaging 1.00
R4666:Pde7b UTSW 10 20438750 missense probably damaging 1.00
R4757:Pde7b UTSW 10 20547942 missense probably benign 0.01
R4823:Pde7b UTSW 10 20438785 missense probably damaging 1.00
R4889:Pde7b UTSW 10 20548077 missense probably benign 0.16
R4910:Pde7b UTSW 10 20724734 unclassified probably benign
R4923:Pde7b UTSW 10 20413127 missense probably damaging 0.98
R5349:Pde7b UTSW 10 20619186 missense probably damaging 0.99
R6258:Pde7b UTSW 10 20440800 missense possibly damaging 0.93
R6645:Pde7b UTSW 10 20610566 critical splice donor site probably null
R7000:Pde7b UTSW 10 20443292 missense probably damaging 1.00
R7510:Pde7b UTSW 10 20413015 missense possibly damaging 0.83
R7817:Pde7b UTSW 10 20443305 missense probably damaging 1.00
R8692:Pde7b UTSW 10 20547893 missense probably benign 0.10
R8837:Pde7b UTSW 10 20438723 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCATTTAGATCTCTGGAAGGC -3'
(R):5'- TCAAAGGAGCCACTGTTAGGG -3'

Sequencing Primer
(F):5'- CATTTAGATCTCTGGAAGGCTGTGTG -3'
(R):5'- CCACTGTTAGGGATTGTTGATGCC -3'
Posted On 2019-11-12