Incidental Mutation 'R7717:Lrrc37a'
ID 594989
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Name leucine rich repeat containing 37A
Synonyms LOC237954
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 103341535-103395423 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103395126 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 100 (S100P)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000153273
AA Change: S100P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: S100P

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 T C 17: 43,761,644 (GRCm39) L1113P probably damaging Het
Aldh3b3 T C 19: 4,013,970 (GRCm39) L57P probably damaging Het
Asb15 A G 6: 24,559,251 (GRCm39) D132G probably benign Het
Cep290 C T 10: 100,328,543 (GRCm39) R111W probably benign Het
Cfap44 A G 16: 44,250,298 (GRCm39) D792G probably damaging Het
Col20a1 C T 2: 180,649,408 (GRCm39) R1029W probably damaging Het
Csf3r A G 4: 125,931,403 (GRCm39) Y462C probably damaging Het
Cthrc1 T C 15: 38,940,511 (GRCm39) V38A probably benign Het
Cxcr2 T C 1: 74,197,998 (GRCm39) V164A probably benign Het
Efr3b A G 12: 4,034,574 (GRCm39) S199P probably damaging Het
Elavl4 A G 4: 110,063,663 (GRCm39) C342R probably damaging Het
Gemin5 A T 11: 58,042,356 (GRCm39) probably null Het
Gm14190 A T 11: 99,581,476 (GRCm39) C31S unknown Het
Golt1b T A 6: 142,339,769 (GRCm39) V78D probably damaging Het
Gsdmc3 T A 15: 63,741,061 (GRCm39) D29V probably damaging Het
Itih1 T A 14: 30,653,142 (GRCm39) D766V probably damaging Het
Larp1b C T 3: 40,926,879 (GRCm39) S251F probably damaging Het
Lrp8 A G 4: 107,691,940 (GRCm39) T115A probably benign Het
Lss T C 10: 76,381,286 (GRCm39) V424A possibly damaging Het
Ltbp1 T C 17: 75,597,073 (GRCm39) V568A possibly damaging Het
Myo10 A T 15: 25,732,056 (GRCm39) T311S probably benign Het
Nsd3 T C 8: 26,172,578 (GRCm39) V779A probably benign Het
Or10ak12 A T 4: 118,666,130 (GRCm39) S310R probably damaging Het
Or11h23 T A 14: 50,948,219 (GRCm39) L144Q probably damaging Het
Or2ag16 A G 7: 106,351,843 (GRCm39) W251R possibly damaging Het
Or2n1e C A 17: 38,586,471 (GRCm39) Q270K probably damaging Het
Or51v8 T C 7: 103,320,152 (GRCm39) T29A probably benign Het
Or5b21 A T 19: 12,839,159 (GRCm39) I7F probably benign Het
Pak1 T A 7: 97,535,555 (GRCm39) D215E probably benign Het
Pde7b A G 10: 20,282,937 (GRCm39) F355L probably benign Het
Phaf1 C A 8: 105,978,236 (GRCm39) Q397K probably benign Het
Pi4ka A G 16: 17,194,787 (GRCm39) S204P Het
Pirb T C 7: 3,720,782 (GRCm39) K239E not run Het
Pirb C T 7: 3,720,800 (GRCm39) G233R not run Het
Pnp G A 14: 51,188,460 (GRCm39) M211I probably benign Het
Pot1a A T 6: 25,758,822 (GRCm39) L319Q probably benign Het
Rspry1 G T 8: 95,349,750 (GRCm39) C46F probably damaging Het
Sanbr A C 11: 23,556,757 (GRCm39) C408G probably benign Het
Sec11c C T 18: 65,945,783 (GRCm39) T82M possibly damaging Het
Secisbp2 T C 13: 51,827,134 (GRCm39) V414A probably benign Het
Tenm2 A G 11: 36,755,762 (GRCm39) F79L probably damaging Het
Vmn2r2 A G 3: 64,042,019 (GRCm39) V232A possibly damaging Het
Zbtb17 T C 4: 141,193,394 (GRCm39) S593P probably damaging Het
Zfp143 T G 7: 109,685,427 (GRCm39) C419G possibly damaging Het
Zfp804b T C 5: 6,821,293 (GRCm39) N590S possibly damaging Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103,391,177 (GRCm39) missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103,388,763 (GRCm39) missense unknown
IGL01352:Lrrc37a APN 11 103,390,181 (GRCm39) missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103,389,581 (GRCm39) missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103,394,687 (GRCm39) missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103,395,090 (GRCm39) missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103,389,245 (GRCm39) missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103,347,317 (GRCm39) missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103,395,365 (GRCm39) missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103,388,435 (GRCm39) missense unknown
IGL02218:Lrrc37a APN 11 103,391,207 (GRCm39) missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103,389,003 (GRCm39) missense unknown
IGL02487:Lrrc37a APN 11 103,386,863 (GRCm39) missense unknown
IGL02597:Lrrc37a APN 11 103,395,113 (GRCm39) missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103,389,938 (GRCm39) missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103,392,132 (GRCm39) missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103,382,000 (GRCm39) missense unknown
IGL02987:Lrrc37a APN 11 103,391,239 (GRCm39) missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103,347,421 (GRCm39) missense unknown
IGL03210:Lrrc37a APN 11 103,390,331 (GRCm39) missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103,390,233 (GRCm39) missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03296:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03299:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03370:Lrrc37a APN 11 103,388,499 (GRCm39) missense unknown
IGL03390:Lrrc37a APN 11 103,386,857 (GRCm39) missense unknown
Lark UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
Longspur UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
F5770:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103,393,958 (GRCm39) missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103,395,338 (GRCm39) missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103,391,739 (GRCm39) missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103,390,616 (GRCm39) missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103,391,466 (GRCm39) missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103,355,221 (GRCm39) missense unknown
R0418:Lrrc37a UTSW 11 103,394,264 (GRCm39) missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103,393,851 (GRCm39) missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103,388,457 (GRCm39) missense unknown
R1581:Lrrc37a UTSW 11 103,347,843 (GRCm39) nonsense probably null
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103,389,587 (GRCm39) missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103,347,982 (GRCm39) missense unknown
R1982:Lrrc37a UTSW 11 103,389,792 (GRCm39) missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103,391,951 (GRCm39) missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103,391,087 (GRCm39) missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103,388,648 (GRCm39) missense unknown
R2190:Lrrc37a UTSW 11 103,390,869 (GRCm39) missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103,392,293 (GRCm39) missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R2899:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3439:Lrrc37a UTSW 11 103,388,690 (GRCm39) missense unknown
R3899:Lrrc37a UTSW 11 103,388,372 (GRCm39) missense unknown
R3916:Lrrc37a UTSW 11 103,346,344 (GRCm39) missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103,392,296 (GRCm39) missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103,348,430 (GRCm39) missense unknown
R4043:Lrrc37a UTSW 11 103,389,479 (GRCm39) missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103,388,808 (GRCm39) missense unknown
R4237:Lrrc37a UTSW 11 103,393,115 (GRCm39) missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103,355,180 (GRCm39) critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103,392,624 (GRCm39) missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103,389,795 (GRCm39) missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103,395,363 (GRCm39) missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103,394,930 (GRCm39) missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103,346,306 (GRCm39) missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103,395,135 (GRCm39) missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103,388,438 (GRCm39) missense unknown
R4983:Lrrc37a UTSW 11 103,388,444 (GRCm39) missense unknown
R4989:Lrrc37a UTSW 11 103,347,565 (GRCm39) missense unknown
R5046:Lrrc37a UTSW 11 103,389,066 (GRCm39) missense unknown
R5217:Lrrc37a UTSW 11 103,347,780 (GRCm39) missense unknown
R5300:Lrrc37a UTSW 11 103,347,784 (GRCm39) missense unknown
R5509:Lrrc37a UTSW 11 103,391,361 (GRCm39) missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103,389,003 (GRCm39) missense unknown
R5655:Lrrc37a UTSW 11 103,389,381 (GRCm39) missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103,391,001 (GRCm39) missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103,348,923 (GRCm39) missense unknown
R5815:Lrrc37a UTSW 11 103,394,612 (GRCm39) missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103,389,897 (GRCm39) missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103,391,784 (GRCm39) missense probably benign 0.19
R6004:Lrrc37a UTSW 11 103,393,362 (GRCm39) missense possibly damaging 0.56
R6019:Lrrc37a UTSW 11 103,347,422 (GRCm39) missense unknown
R6056:Lrrc37a UTSW 11 103,388,484 (GRCm39) missense unknown
R6125:Lrrc37a UTSW 11 103,392,386 (GRCm39) missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103,392,042 (GRCm39) missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103,388,459 (GRCm39) missense unknown
R6320:Lrrc37a UTSW 11 103,394,877 (GRCm39) missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103,355,213 (GRCm39) missense unknown
R6375:Lrrc37a UTSW 11 103,391,915 (GRCm39) missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103,388,361 (GRCm39) missense unknown
R6468:Lrrc37a UTSW 11 103,351,666 (GRCm39) missense unknown
R6490:Lrrc37a UTSW 11 103,347,486 (GRCm39) missense unknown
R6502:Lrrc37a UTSW 11 103,383,005 (GRCm39) missense unknown
R6509:Lrrc37a UTSW 11 103,395,240 (GRCm39) missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103,392,923 (GRCm39) missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103,390,949 (GRCm39) missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103,348,369 (GRCm39) missense unknown
R7081:Lrrc37a UTSW 11 103,348,781 (GRCm39) missense unknown
R7083:Lrrc37a UTSW 11 103,394,166 (GRCm39) missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103,393,682 (GRCm39) missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103,348,601 (GRCm39) missense unknown
R7265:Lrrc37a UTSW 11 103,389,767 (GRCm39) missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103,347,572 (GRCm39) missense unknown
R7362:Lrrc37a UTSW 11 103,348,335 (GRCm39) missense unknown
R7450:Lrrc37a UTSW 11 103,389,152 (GRCm39) missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103,388,258 (GRCm39) missense unknown
R7487:Lrrc37a UTSW 11 103,389,045 (GRCm39) missense unknown
R7535:Lrrc37a UTSW 11 103,392,683 (GRCm39) missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103,391,778 (GRCm39) missense probably benign 0.03
R7677:Lrrc37a UTSW 11 103,390,464 (GRCm39) missense probably benign 0.26
R7686:Lrrc37a UTSW 11 103,389,062 (GRCm39) missense unknown
R7694:Lrrc37a UTSW 11 103,395,204 (GRCm39) missense probably benign 0.12
R7696:Lrrc37a UTSW 11 103,389,263 (GRCm39) missense probably benign 0.01
R7736:Lrrc37a UTSW 11 103,388,285 (GRCm39) missense unknown
R7841:Lrrc37a UTSW 11 103,391,931 (GRCm39) missense probably benign 0.03
R7885:Lrrc37a UTSW 11 103,393,868 (GRCm39) missense probably benign 0.01
R7888:Lrrc37a UTSW 11 103,392,307 (GRCm39) missense probably benign 0.19
R7993:Lrrc37a UTSW 11 103,348,787 (GRCm39) missense unknown
R8051:Lrrc37a UTSW 11 103,393,952 (GRCm39) missense possibly damaging 0.48
R8082:Lrrc37a UTSW 11 103,348,248 (GRCm39) missense unknown
R8097:Lrrc37a UTSW 11 103,394,925 (GRCm39) missense probably benign 0.04
R8108:Lrrc37a UTSW 11 103,393,883 (GRCm39) missense probably benign 0.24
R8269:Lrrc37a UTSW 11 103,388,724 (GRCm39) missense unknown
R8311:Lrrc37a UTSW 11 103,394,247 (GRCm39) missense probably benign 0.05
R8403:Lrrc37a UTSW 11 103,392,411 (GRCm39) missense probably benign 0.10
R8408:Lrrc37a UTSW 11 103,351,635 (GRCm39) missense unknown
R8529:Lrrc37a UTSW 11 103,348,373 (GRCm39) missense unknown
R8711:Lrrc37a UTSW 11 103,388,350 (GRCm39) nonsense probably null
R8757:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8759:Lrrc37a UTSW 11 103,348,766 (GRCm39) missense unknown
R8769:Lrrc37a UTSW 11 103,389,536 (GRCm39) missense probably benign 0.10
R8785:Lrrc37a UTSW 11 103,347,242 (GRCm39) missense probably damaging 1.00
R8837:Lrrc37a UTSW 11 103,394,795 (GRCm39) missense probably benign 0.43
R8850:Lrrc37a UTSW 11 103,393,481 (GRCm39) missense
R8871:Lrrc37a UTSW 11 103,347,375 (GRCm39) missense unknown
R8894:Lrrc37a UTSW 11 103,347,449 (GRCm39) missense unknown
R8971:Lrrc37a UTSW 11 103,391,490 (GRCm39) missense probably benign 0.19
R8979:Lrrc37a UTSW 11 103,393,833 (GRCm39) missense possibly damaging 0.48
R9012:Lrrc37a UTSW 11 103,389,978 (GRCm39) missense probably benign 0.05
R9047:Lrrc37a UTSW 11 103,391,375 (GRCm39) missense probably damaging 0.97
R9167:Lrrc37a UTSW 11 103,347,658 (GRCm39) missense unknown
R9171:Lrrc37a UTSW 11 103,393,140 (GRCm39) missense probably benign 0.42
R9194:Lrrc37a UTSW 11 103,391,676 (GRCm39) missense probably benign 0.03
R9258:Lrrc37a UTSW 11 103,393,022 (GRCm39) missense probably benign 0.20
R9282:Lrrc37a UTSW 11 103,391,633 (GRCm39) missense probably benign 0.03
R9294:Lrrc37a UTSW 11 103,395,359 (GRCm39) missense probably benign 0.10
R9349:Lrrc37a UTSW 11 103,388,454 (GRCm39) missense unknown
R9560:Lrrc37a UTSW 11 103,347,420 (GRCm39) missense unknown
R9595:Lrrc37a UTSW 11 103,392,552 (GRCm39) missense probably benign 0.01
R9628:Lrrc37a UTSW 11 103,394,330 (GRCm39) missense probably benign 0.03
V7580:Lrrc37a UTSW 11 103,346,338 (GRCm39) missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103,390,370 (GRCm39) missense possibly damaging 0.78
Z1176:Lrrc37a UTSW 11 103,391,920 (GRCm39) missense probably benign 0.09
Z1176:Lrrc37a UTSW 11 103,389,860 (GRCm39) missense possibly damaging 0.68
Z1176:Lrrc37a UTSW 11 103,347,312 (GRCm39) missense probably damaging 1.00
Z1177:Lrrc37a UTSW 11 103,391,346 (GRCm39) missense probably benign 0.43
Z1177:Lrrc37a UTSW 11 103,390,793 (GRCm39) missense possibly damaging 0.46
Z1177:Lrrc37a UTSW 11 103,393,853 (GRCm39) missense probably benign 0.20
Z1177:Lrrc37a UTSW 11 103,391,424 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GGATGTTCAATCTTCTCAGAAGGC -3'
(R):5'- AGCACTTGGCCAAGCAAATG -3'

Sequencing Primer
(F):5'- AGAAGGCCCCTCTCGGTTTG -3'
(R):5'- TTGGCCAAGCAAATGACTCC -3'
Posted On 2019-11-12