Incidental Mutation 'R7717:Itih1'
ID594992
Institutional Source Beutler Lab
Gene Symbol Itih1
Ensembl Gene ENSMUSG00000006529
Gene Nameinter-alpha trypsin inhibitor, heavy chain 1
Synonymsinter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1, Intin1
Accession Numbers

Genbank: NM_008406.3; Ensembl: ENSMUST00000163118

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7717 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location30929180-30943289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30931185 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 766 (D766V)
Ref Sequence ENSEMBL: ENSMUSP00000006704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006704] [ENSMUST00000163118]
Predicted Effect probably damaging
Transcript: ENSMUST00000006704
AA Change: D766V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006704
Gene: ENSMUSG00000006529
AA Change: D766V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 167 6e-79 SMART
low complexity region 240 251 N/A INTRINSIC
VWA 291 472 2.1e-32 SMART
Blast:VWA 528 577 5e-21 BLAST
Pfam:ITI_HC_C 706 892 2.1e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163118
AA Change: D762V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126449
Gene: ENSMUSG00000006529
AA Change: D762V

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 163 2.44e-80 SMART
low complexity region 236 247 N/A INTRINSIC
VWA 287 468 3.43e-30 SMART
Blast:VWA 524 573 5e-21 BLAST
Pfam:ITI_HC_C 701 888 5.3e-81 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a heavy chain of inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors. IaI proteins are protein-glycosaminoglycan-protein complexes comprised of two heavy chains and a light chain. The encoded protein covalently associates with the light chain via a chondroitin sulfate moiety. Intravenous administration of the encoded protein improved survival of mice after infection with Escherichia coli. This gene is located adjacent to two other IaI heavy chain genes. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature protein. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Itih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Itih1 APN 14 30929821 missense probably benign 0.26
IGL00227:Itih1 APN 14 30942889 splice site probably null
IGL00902:Itih1 APN 14 30932482 splice site probably benign
IGL02194:Itih1 APN 14 30930365 missense probably benign 0.01
IGL02221:Itih1 APN 14 30929587 missense probably damaging 1.00
IGL02292:Itih1 APN 14 30933355 splice site probably null
IGL02733:Itih1 APN 14 30936720 missense probably damaging 1.00
IGL02928:Itih1 APN 14 30937758 missense probably damaging 1.00
IGL03064:Itih1 APN 14 30941557 missense probably benign 0.09
1mM(1):Itih1 UTSW 14 30929850 missense probably damaging 1.00
R0092:Itih1 UTSW 14 30940863 splice site probably benign
R0647:Itih1 UTSW 14 30935863 missense probably damaging 1.00
R0662:Itih1 UTSW 14 30933360 missense possibly damaging 0.63
R0744:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R0833:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R1070:Itih1 UTSW 14 30942456 splice site probably benign
R1397:Itih1 UTSW 14 30929905 splice site probably benign
R1797:Itih1 UTSW 14 30929899 missense probably damaging 1.00
R1898:Itih1 UTSW 14 30932287 missense probably benign
R1964:Itih1 UTSW 14 30929623 missense probably damaging 1.00
R1967:Itih1 UTSW 14 30941984 missense possibly damaging 0.67
R2086:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R2155:Itih1 UTSW 14 30938071 missense probably damaging 1.00
R2156:Itih1 UTSW 14 30933475 missense possibly damaging 0.88
R2225:Itih1 UTSW 14 30929577 missense possibly damaging 0.88
R3836:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3837:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3839:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R4388:Itih1 UTSW 14 30941555 missense possibly damaging 0.93
R4504:Itih1 UTSW 14 30935885 missense probably damaging 1.00
R4618:Itih1 UTSW 14 30929831 missense probably benign 0.33
R4682:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R4856:Itih1 UTSW 14 30936701 critical splice donor site probably null
R4886:Itih1 UTSW 14 30936701 critical splice donor site probably null
R5169:Itih1 UTSW 14 30933446 nonsense probably null
R5773:Itih1 UTSW 14 30935399 missense possibly damaging 0.89
R5875:Itih1 UTSW 14 30929530 missense probably benign
R6048:Itih1 UTSW 14 30929823 missense possibly damaging 0.89
R6077:Itih1 UTSW 14 30929876 missense possibly damaging 0.75
R6175:Itih1 UTSW 14 30931195 missense probably damaging 1.00
R6228:Itih1 UTSW 14 30931260 missense probably benign 0.00
R6664:Itih1 UTSW 14 30933436 missense probably damaging 1.00
R6675:Itih1 UTSW 14 30929841 missense possibly damaging 0.50
R7059:Itih1 UTSW 14 30931309 missense possibly damaging 0.93
R7168:Itih1 UTSW 14 30934107 missense probably null 0.98
R7408:Itih1 UTSW 14 30943160 missense probably benign 0.00
R7458:Itih1 UTSW 14 30943266 start codon destroyed probably null
R8016:Itih1 UTSW 14 30935294 missense probably damaging 0.96
R8035:Itih1 UTSW 14 30942525 missense probably benign 0.25
Z1177:Itih1 UTSW 14 30929572 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- ATCTGTACAGGCCTTATGCG -3'
(R):5'- AAGGATATTCGACGTGCCAAAG -3'

Sequencing Primer
(F):5'- AGGCCTTATGCGTGTCCC -3'
(R):5'- TGCAGGCTTCACCGTGAATG -3'
Posted On2019-11-12