Incidental Mutation 'R7717:Pnp'
ID594994
Institutional Source Beutler Lab
Gene Symbol Pnp
Ensembl Gene ENSMUSG00000115338
Gene Namepurine-nucleoside phosphorylase
SynonymsNp, Np-1, Np-2, Pnp, Pnp1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R7717 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location50931082-50965237 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50951003 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 211 (M211I)
Ref Sequence ENSEMBL: ENSMUSP00000043926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048615] [ENSMUST00000095925] [ENSMUST00000178092] [ENSMUST00000226871] [ENSMUST00000227052]
Predicted Effect probably benign
Transcript: ENSMUST00000048615
AA Change: M211I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000043926
Gene: ENSMUSG00000115338
AA Change: M211I

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 26 280 5.2e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095925
SMART Domains Protein: ENSMUSP00000093615
Gene: ENSMUSG00000068417

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 41 295 4.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178092
AA Change: M211I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136557
Gene: ENSMUSG00000115338
AA Change: M211I

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 26 280 2e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226871
Predicted Effect probably benign
Transcript: ENSMUST00000227052
AA Change: M233I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Nullizygous mice show impaired thymocyte differentiation, T cell function and mitochondrial DNA repair, altered lymphocyte subpopulations and metabolism, and enhanced thymocyte apoptosis and sensitivity to gamma-irradiation. ENU-induced mutants show a gradual decline in T cell number and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Pnp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Pnp APN 14 50951002 missense probably benign
IGL01824:Pnp APN 14 50951413 missense probably damaging 1.00
IGL02649:Pnp APN 14 50947846 splice site probably benign
IGL03148:Pnp APN 14 50950728 splice site probably benign
Porch UTSW 14 50950923 nonsense probably null
porch2 UTSW 14 50951506 nonsense probably null
R0097:Pnp UTSW 14 50951416 missense probably damaging 1.00
R1510:Pnp UTSW 14 50950585 missense possibly damaging 0.80
R1823:Pnp UTSW 14 50950329 missense probably damaging 1.00
R1864:Pnp UTSW 14 50947973 missense probably benign 0.00
R3429:Pnp UTSW 14 50947986 missense probably benign 0.10
R4639:Pnp UTSW 14 50950923 nonsense probably null
R5078:Pnp UTSW 14 50951506 nonsense probably null
R5982:Pnp UTSW 14 50950543 missense probably damaging 1.00
R6431:Pnp UTSW 14 50951014 missense probably damaging 1.00
R7016:Pnp UTSW 14 50950249 splice site probably null
R7249:Pnp UTSW 14 50951430 missense probably benign 0.11
R7302:Pnp UTSW 14 50950947 missense probably damaging 0.96
Z1088:Pnp UTSW 14 50951495 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGAGATAATCCCACCTGTGTTC -3'
(R):5'- CTTGCAGCCACAGGTAGAGAAG -3'

Sequencing Primer
(F):5'- GCTTTCAGTGCCTGGAAA -3'
(R):5'- AGAGAAGGTGGCTGTACTTACATTC -3'
Posted On2019-11-12