Mutagenetix > Incidental Mutation

Incidental Mutation 'R7717:Myo10'

594995

Institutional Source

Beutler Lab

Gene Symbol

Myo10

Ensembl Gene

ENSMUSG00000022272

Gene Name

myosin X

Synonyms

D15Ertd600e, myosin-X

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7717 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

25622525-25813673 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 25731970 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 311 (T311S)

Ref Sequence

ENSEMBL: ENSMUSP00000106087 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110457] [ENSMUST00000137601]

AlphaFold

F8VQB6

Predicted Effect

probably benign
Transcript: ENSMUST00000110457
AA Change: T311S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272
AA Change: T311S

Domain	Start	End	E-Value	Type
MYSc	57	740	N/A	SMART
IQ	741	763	1.27e-3	SMART
IQ	764	786	1.06e0	SMART
IQ	787	809	7.07e-2	SMART
Pfam:MYO10_CC	881	932	4.2e-22	PFAM
low complexity region	959	981	N/A	INTRINSIC
low complexity region	1090	1102	N/A	INTRINSIC
low complexity region	1147	1165	N/A	INTRINSIC
PH	1217	1316	1.39e-21	SMART
PH	1397	1503	6.76e-11	SMART
MyTH4	1551	1699	4.12e-37	SMART
B41	1700	1962	1.72e-44	SMART
low complexity region	2050	2062	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137601
AA Change: T278S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000118280
Gene: ENSMUSG00000022272
AA Change: T278S

Domain	Start	End	E-Value	Type
MYSc	24	707	N/A	SMART
IQ	708	730	1.27e-3	SMART
IQ	731	753	1.06e0	SMART
IQ	754	776	7.07e-2	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,606,757	C408G	probably benign	Het
Adgrf5	T	C	17: 43,450,753	L1113P	probably damaging	Het
Aldh3b3	T	C	19: 3,963,970	L57P	probably damaging	Het
Asb15	A	G	6: 24,559,252	D132G	probably benign	Het
Cep290	C	T	10: 100,492,681	R111W	probably benign	Het
Cfap44	A	G	16: 44,429,935	D792G	probably damaging	Het
Col20a1	C	T	2: 181,007,615	R1029W	probably damaging	Het
Csf3r	A	G	4: 126,037,610	Y462C	probably damaging	Het
Cthrc1	T	C	15: 39,077,116	V38A	probably benign	Het
Cxcr2	T	C	1: 74,158,839	V164A	probably benign	Het
D230025D16Rik	C	A	8: 105,251,604	Q397K	probably benign	Het
Efr3b	A	G	12: 3,984,574	S199P	probably damaging	Het
Elavl4	A	G	4: 110,206,466	C342R	probably damaging	Het
Gemin5	A	T	11: 58,151,530		probably null	Het
Gm14190	A	T	11: 99,690,650	C31S	unknown	Het
Golt1b	T	A	6: 142,394,043	V78D	probably damaging	Het
Gsdmc3	T	A	15: 63,869,212	D29V	probably damaging	Het
Itih1	T	A	14: 30,931,185	D766V	probably damaging	Het
Larp1b	C	T	3: 40,972,444	S251F	probably damaging	Het
Lrp8	A	G	4: 107,834,743	T115A	probably benign	Het
Lrrc37a	A	G	11: 103,504,300	S100P	probably benign	Het
Lss	T	C	10: 76,545,452	V424A	possibly damaging	Het
Ltbp1	T	C	17: 75,290,078	V568A	possibly damaging	Het
Nsd3	T	C	8: 25,682,562	V779A	probably benign	Het
Olfr1335	A	T	4: 118,808,933	S310R	probably damaging	Het
Olfr138	C	A	17: 38,275,580	Q270K	probably damaging	Het
Olfr1444	A	T	19: 12,861,795	I7F	probably benign	Het
Olfr624	T	C	7: 103,670,945	T29A	probably benign	Het
Olfr698	A	G	7: 106,752,636	W251R	possibly damaging	Het
Olfr748	T	A	14: 50,710,762	L144Q	probably damaging	Het
Pak1	T	A	7: 97,886,348	D215E	probably benign	Het
Pde7b	A	G	10: 20,407,191	F355L	probably benign	Het
Pi4ka	A	G	16: 17,376,923	S204P		Het
Pirb	T	C	7: 3,717,783	K239E	not run	Het
Pirb	C	T	7: 3,717,801	G233R	not run	Het
Pnp	G	A	14: 50,951,003	M211I	probably benign	Het
Pot1a	A	T	6: 25,758,823	L319Q	probably benign	Het
Rspry1	G	T	8: 94,623,122	C46F	probably damaging	Het
Sec11c	C	T	18: 65,812,712	T82M	possibly damaging	Het
Secisbp2	T	C	13: 51,673,098	V414A	probably benign	Het
Tenm2	A	G	11: 36,864,935	F79L	probably damaging	Het
Vmn2r2	A	G	3: 64,134,598	V232A	possibly damaging	Het
Zbtb17	T	C	4: 141,466,083	S593P	probably damaging	Het
Zfp143	T	G	7: 110,086,220	C419G	possibly damaging	Het
Zfp804b	T	C	5: 6,771,293	N590S	possibly damaging	Het

Other mutations in Myo10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00557:Myo10	APN	15	25776380	missense	probably damaging	1.00
IGL01068:Myo10	APN	15	25739309	missense	possibly damaging	0.93
IGL01352:Myo10	APN	15	25701697	missense	probably damaging	1.00
IGL01388:Myo10	APN	15	25736617	missense	possibly damaging	0.55
IGL01460:Myo10	APN	15	25714108	missense	probably benign	0.00
IGL01553:Myo10	APN	15	25776329	missense	probably damaging	1.00
IGL01732:Myo10	APN	15	25732063	missense	probably benign	0.10
IGL01992:Myo10	APN	15	25799548	missense	possibly damaging	0.92
IGL02000:Myo10	APN	15	25808066	missense	probably damaging	1.00
IGL02045:Myo10	APN	15	25726488	missense	probably benign	0.03
IGL02307:Myo10	APN	15	25776315	splice site	probably benign
IGL02511:Myo10	APN	15	25723889	missense	probably damaging	0.97
IGL03240:Myo10	APN	15	25701602	missense	probably damaging	1.00
least	UTSW	15	25726475	nonsense	probably null
R0037:Myo10	UTSW	15	25666532	intron	probably benign
R0153:Myo10	UTSW	15	25781238	missense	possibly damaging	0.84
R0282:Myo10	UTSW	15	25793167	missense	probably damaging	1.00
R0360:Myo10	UTSW	15	25804368	missense	probably damaging	1.00
R0585:Myo10	UTSW	15	25736455	missense	probably damaging	1.00
R0617:Myo10	UTSW	15	25738005	missense	probably damaging	1.00
R0729:Myo10	UTSW	15	25722157	splice site	probably benign
R0771:Myo10	UTSW	15	25778178	missense	probably damaging	1.00
R0960:Myo10	UTSW	15	25801189	missense	probably damaging	1.00
R1562:Myo10	UTSW	15	25780411	missense	possibly damaging	0.81
R1651:Myo10	UTSW	15	25742369	missense	probably damaging	1.00
R1789:Myo10	UTSW	15	25726525	critical splice donor site	probably null
R1816:Myo10	UTSW	15	25800200	missense	probably damaging	1.00
R1835:Myo10	UTSW	15	25805587	missense	possibly damaging	0.53
R1908:Myo10	UTSW	15	25801222	missense	probably damaging	1.00
R2082:Myo10	UTSW	15	25785993	missense	probably damaging	1.00
R2101:Myo10	UTSW	15	25722259	missense	probably benign	0.26
R2129:Myo10	UTSW	15	25781799	missense	probably benign	0.09
R2141:Myo10	UTSW	15	25714108	missense	probably benign
R2142:Myo10	UTSW	15	25714108	missense	probably benign
R2920:Myo10	UTSW	15	25801140	missense	probably damaging	1.00
R2938:Myo10	UTSW	15	25795717	missense	probably damaging	0.99
R3723:Myo10	UTSW	15	25803288	missense	probably damaging	1.00
R3852:Myo10	UTSW	15	25779626	missense	probably damaging	1.00
R4162:Myo10	UTSW	15	25726415	splice site	probably null
R4163:Myo10	UTSW	15	25726415	splice site	probably null
R4164:Myo10	UTSW	15	25726415	splice site	probably null
R4177:Myo10	UTSW	15	25734051	missense	possibly damaging	0.81
R4409:Myo10	UTSW	15	25807869	missense	probably damaging	1.00
R4667:Myo10	UTSW	15	25793153	missense	possibly damaging	0.91
R4905:Myo10	UTSW	15	25800212	missense	probably damaging	0.99
R4933:Myo10	UTSW	15	25781118	missense	probably damaging	0.96
R4968:Myo10	UTSW	15	25808184	missense	probably damaging	1.00
R5081:Myo10	UTSW	15	25785940	missense	probably damaging	1.00
R5123:Myo10	UTSW	15	25726483	missense	possibly damaging	0.94
R5310:Myo10	UTSW	15	25778078	splice site	probably null
R6073:Myo10	UTSW	15	25736642	missense	probably damaging	1.00
R6117:Myo10	UTSW	15	25805659	missense	probably benign	0.00
R6185:Myo10	UTSW	15	25726510	missense	probably damaging	0.99
R6749:Myo10	UTSW	15	25714110	missense	probably damaging	1.00
R6819:Myo10	UTSW	15	25781410	missense	possibly damaging	0.80
R6875:Myo10	UTSW	15	25805659	missense	probably benign	0.00
R6908:Myo10	UTSW	15	25804383	missense	probably damaging	1.00
R6963:Myo10	UTSW	15	25734063	missense	probably benign	0.31
R7144:Myo10	UTSW	15	25723925	missense	probably damaging	1.00
R7266:Myo10	UTSW	15	25782981	missense	probably damaging	1.00
R7380:Myo10	UTSW	15	25779620	missense	probably benign	0.01
R7460:Myo10	UTSW	15	25807827	missense	probably damaging	1.00
R7614:Myo10	UTSW	15	25701623	missense	probably benign	0.00
R7618:Myo10	UTSW	15	25726475	nonsense	probably null
R7811:Myo10	UTSW	15	25804524	missense	probably damaging	1.00
R7830:Myo10	UTSW	15	25737971	nonsense	probably null
R7862:Myo10	UTSW	15	25666436	missense	probably damaging	1.00
R8232:Myo10	UTSW	15	25804314	missense	possibly damaging	0.89
R8264:Myo10	UTSW	15	25800109	missense	probably damaging	0.99
R8377:Myo10	UTSW	15	25804395	missense	possibly damaging	0.94
R8385:Myo10	UTSW	15	25804398	missense	probably damaging	1.00
R8426:Myo10	UTSW	15	25799490	missense	probably damaging	0.99
R8439:Myo10	UTSW	15	25725072	missense	probably benign	0.00
R8696:Myo10	UTSW	15	25799486	missense	probably damaging	1.00
R8775:Myo10	UTSW	15	25800059	missense	probably damaging	0.97
R8775-TAIL:Myo10	UTSW	15	25800059	missense	probably damaging	0.97
R8970:Myo10	UTSW	15	25803381	missense	possibly damaging	0.82
R9024:Myo10	UTSW	15	25793209	missense	possibly damaging	0.53
R9196:Myo10	UTSW	15	25805630	missense	probably damaging	0.96
R9224:Myo10	UTSW	15	25807995	missense	probably benign	0.33
R9308:Myo10	UTSW	15	25781776	missense	probably damaging	0.99
R9358:Myo10	UTSW	15	25781434	missense	possibly damaging	0.69
R9606:Myo10	UTSW	15	25776315	frame shift	probably null
R9722:Myo10	UTSW	15	25801141	missense	probably damaging	1.00
RF013:Myo10	UTSW	15	25799479	missense	probably damaging	0.99
Z1177:Myo10	UTSW	15	25781401	missense	probably damaging	1.00
Z1177:Myo10	UTSW	15	25799554	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACACGTGTGGCCATCTACTG -3'
(R):5'- GTCTAGTCTCTTGTAAGGAAAGCAC -3'

Sequencing Primer
(F):5'- CAGTGGTTATGCATCAGTGT -3'
(R):5'- TCTCTTGTAAGGAAAGCACTGAAG -3'

Posted On

2019-11-12