Incidental Mutation 'R7717:Myo10'
ID 594995
Institutional Source Beutler Lab
Gene Symbol Myo10
Ensembl Gene ENSMUSG00000022272
Gene Name myosin X
Synonyms myosin-X, D15Ertd600e
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 25622636-25813759 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25732056 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 311 (T311S)
Ref Sequence ENSEMBL: ENSMUSP00000106087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110457] [ENSMUST00000137601]
AlphaFold F8VQB6
Predicted Effect probably benign
Transcript: ENSMUST00000110457
AA Change: T311S

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106087
Gene: ENSMUSG00000022272
AA Change: T311S

DomainStartEndE-ValueType
MYSc 57 740 N/A SMART
IQ 741 763 1.27e-3 SMART
IQ 764 786 1.06e0 SMART
IQ 787 809 7.07e-2 SMART
Pfam:MYO10_CC 881 932 4.2e-22 PFAM
low complexity region 959 981 N/A INTRINSIC
low complexity region 1090 1102 N/A INTRINSIC
low complexity region 1147 1165 N/A INTRINSIC
PH 1217 1316 1.39e-21 SMART
PH 1397 1503 6.76e-11 SMART
MyTH4 1551 1699 4.12e-37 SMART
B41 1700 1962 1.72e-44 SMART
low complexity region 2050 2062 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137601
AA Change: T278S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118280
Gene: ENSMUSG00000022272
AA Change: T278S

DomainStartEndE-ValueType
MYSc 24 707 N/A SMART
IQ 708 730 1.27e-3 SMART
IQ 731 753 1.06e0 SMART
IQ 754 776 7.07e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myosin superfamily. The protein represents an unconventional myosin; it should not be confused with the conventional non-muscle myosin-10 (MYH10). Unconventional myosins contain the basic domains of conventional myosins and are further distinguished from class members by their tail domains. This gene functions as an actin-based molecular motor and plays a role in integration of F-actin and microtubule cytoskeletons during meiosis. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mutations are semi-lethal with over half of homozygous embryos exhibiting exencephaly. Surviving mutants show decreased body weight, white spotting, syndactyly, persistence of hyaloid vascular system and other eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 T C 17: 43,761,644 (GRCm39) L1113P probably damaging Het
Aldh3b3 T C 19: 4,013,970 (GRCm39) L57P probably damaging Het
Asb15 A G 6: 24,559,251 (GRCm39) D132G probably benign Het
Cep290 C T 10: 100,328,543 (GRCm39) R111W probably benign Het
Cfap44 A G 16: 44,250,298 (GRCm39) D792G probably damaging Het
Col20a1 C T 2: 180,649,408 (GRCm39) R1029W probably damaging Het
Csf3r A G 4: 125,931,403 (GRCm39) Y462C probably damaging Het
Cthrc1 T C 15: 38,940,511 (GRCm39) V38A probably benign Het
Cxcr2 T C 1: 74,197,998 (GRCm39) V164A probably benign Het
Efr3b A G 12: 4,034,574 (GRCm39) S199P probably damaging Het
Elavl4 A G 4: 110,063,663 (GRCm39) C342R probably damaging Het
Gemin5 A T 11: 58,042,356 (GRCm39) probably null Het
Gm14190 A T 11: 99,581,476 (GRCm39) C31S unknown Het
Golt1b T A 6: 142,339,769 (GRCm39) V78D probably damaging Het
Gsdmc3 T A 15: 63,741,061 (GRCm39) D29V probably damaging Het
Itih1 T A 14: 30,653,142 (GRCm39) D766V probably damaging Het
Larp1b C T 3: 40,926,879 (GRCm39) S251F probably damaging Het
Lrp8 A G 4: 107,691,940 (GRCm39) T115A probably benign Het
Lrrc37a A G 11: 103,395,126 (GRCm39) S100P probably benign Het
Lss T C 10: 76,381,286 (GRCm39) V424A possibly damaging Het
Ltbp1 T C 17: 75,597,073 (GRCm39) V568A possibly damaging Het
Nsd3 T C 8: 26,172,578 (GRCm39) V779A probably benign Het
Or10ak12 A T 4: 118,666,130 (GRCm39) S310R probably damaging Het
Or11h23 T A 14: 50,948,219 (GRCm39) L144Q probably damaging Het
Or2ag16 A G 7: 106,351,843 (GRCm39) W251R possibly damaging Het
Or2n1e C A 17: 38,586,471 (GRCm39) Q270K probably damaging Het
Or51v8 T C 7: 103,320,152 (GRCm39) T29A probably benign Het
Or5b21 A T 19: 12,839,159 (GRCm39) I7F probably benign Het
Pak1 T A 7: 97,535,555 (GRCm39) D215E probably benign Het
Pde7b A G 10: 20,282,937 (GRCm39) F355L probably benign Het
Phaf1 C A 8: 105,978,236 (GRCm39) Q397K probably benign Het
Pi4ka A G 16: 17,194,787 (GRCm39) S204P Het
Pirb T C 7: 3,720,782 (GRCm39) K239E not run Het
Pirb C T 7: 3,720,800 (GRCm39) G233R not run Het
Pnp G A 14: 51,188,460 (GRCm39) M211I probably benign Het
Pot1a A T 6: 25,758,822 (GRCm39) L319Q probably benign Het
Rspry1 G T 8: 95,349,750 (GRCm39) C46F probably damaging Het
Sanbr A C 11: 23,556,757 (GRCm39) C408G probably benign Het
Sec11c C T 18: 65,945,783 (GRCm39) T82M possibly damaging Het
Secisbp2 T C 13: 51,827,134 (GRCm39) V414A probably benign Het
Tenm2 A G 11: 36,755,762 (GRCm39) F79L probably damaging Het
Vmn2r2 A G 3: 64,042,019 (GRCm39) V232A possibly damaging Het
Zbtb17 T C 4: 141,193,394 (GRCm39) S593P probably damaging Het
Zfp143 T G 7: 109,685,427 (GRCm39) C419G possibly damaging Het
Zfp804b T C 5: 6,821,293 (GRCm39) N590S possibly damaging Het
Other mutations in Myo10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Myo10 APN 15 25,776,466 (GRCm39) missense probably damaging 1.00
IGL01068:Myo10 APN 15 25,739,395 (GRCm39) missense possibly damaging 0.93
IGL01352:Myo10 APN 15 25,701,783 (GRCm39) missense probably damaging 1.00
IGL01388:Myo10 APN 15 25,736,703 (GRCm39) missense possibly damaging 0.55
IGL01460:Myo10 APN 15 25,714,194 (GRCm39) missense probably benign 0.00
IGL01553:Myo10 APN 15 25,776,415 (GRCm39) missense probably damaging 1.00
IGL01732:Myo10 APN 15 25,732,149 (GRCm39) missense probably benign 0.10
IGL01992:Myo10 APN 15 25,799,634 (GRCm39) missense possibly damaging 0.92
IGL02000:Myo10 APN 15 25,808,152 (GRCm39) missense probably damaging 1.00
IGL02045:Myo10 APN 15 25,726,574 (GRCm39) missense probably benign 0.03
IGL02307:Myo10 APN 15 25,776,401 (GRCm39) splice site probably benign
IGL02511:Myo10 APN 15 25,723,975 (GRCm39) missense probably damaging 0.97
IGL03240:Myo10 APN 15 25,701,688 (GRCm39) missense probably damaging 1.00
least UTSW 15 25,726,561 (GRCm39) nonsense probably null
R0037:Myo10 UTSW 15 25,666,618 (GRCm39) intron probably benign
R0153:Myo10 UTSW 15 25,781,324 (GRCm39) missense possibly damaging 0.84
R0282:Myo10 UTSW 15 25,793,253 (GRCm39) missense probably damaging 1.00
R0360:Myo10 UTSW 15 25,804,454 (GRCm39) missense probably damaging 1.00
R0585:Myo10 UTSW 15 25,736,541 (GRCm39) missense probably damaging 1.00
R0617:Myo10 UTSW 15 25,738,091 (GRCm39) missense probably damaging 1.00
R0729:Myo10 UTSW 15 25,722,243 (GRCm39) splice site probably benign
R0771:Myo10 UTSW 15 25,778,264 (GRCm39) missense probably damaging 1.00
R0960:Myo10 UTSW 15 25,801,275 (GRCm39) missense probably damaging 1.00
R1562:Myo10 UTSW 15 25,780,497 (GRCm39) missense possibly damaging 0.81
R1651:Myo10 UTSW 15 25,742,455 (GRCm39) missense probably damaging 1.00
R1789:Myo10 UTSW 15 25,726,611 (GRCm39) critical splice donor site probably null
R1816:Myo10 UTSW 15 25,800,286 (GRCm39) missense probably damaging 1.00
R1835:Myo10 UTSW 15 25,805,673 (GRCm39) missense possibly damaging 0.53
R1908:Myo10 UTSW 15 25,801,308 (GRCm39) missense probably damaging 1.00
R2082:Myo10 UTSW 15 25,786,079 (GRCm39) missense probably damaging 1.00
R2101:Myo10 UTSW 15 25,722,345 (GRCm39) missense probably benign 0.26
R2129:Myo10 UTSW 15 25,781,885 (GRCm39) missense probably benign 0.09
R2141:Myo10 UTSW 15 25,714,194 (GRCm39) missense probably benign
R2142:Myo10 UTSW 15 25,714,194 (GRCm39) missense probably benign
R2920:Myo10 UTSW 15 25,801,226 (GRCm39) missense probably damaging 1.00
R2938:Myo10 UTSW 15 25,795,803 (GRCm39) missense probably damaging 0.99
R3723:Myo10 UTSW 15 25,803,374 (GRCm39) missense probably damaging 1.00
R3852:Myo10 UTSW 15 25,779,712 (GRCm39) missense probably damaging 1.00
R4162:Myo10 UTSW 15 25,726,501 (GRCm39) splice site probably null
R4163:Myo10 UTSW 15 25,726,501 (GRCm39) splice site probably null
R4164:Myo10 UTSW 15 25,726,501 (GRCm39) splice site probably null
R4177:Myo10 UTSW 15 25,734,137 (GRCm39) missense possibly damaging 0.81
R4409:Myo10 UTSW 15 25,807,955 (GRCm39) missense probably damaging 1.00
R4667:Myo10 UTSW 15 25,793,239 (GRCm39) missense possibly damaging 0.91
R4905:Myo10 UTSW 15 25,800,298 (GRCm39) missense probably damaging 0.99
R4933:Myo10 UTSW 15 25,781,204 (GRCm39) missense probably damaging 0.96
R4968:Myo10 UTSW 15 25,808,270 (GRCm39) missense probably damaging 1.00
R5081:Myo10 UTSW 15 25,786,026 (GRCm39) missense probably damaging 1.00
R5123:Myo10 UTSW 15 25,726,569 (GRCm39) missense possibly damaging 0.94
R5310:Myo10 UTSW 15 25,778,164 (GRCm39) splice site probably null
R6073:Myo10 UTSW 15 25,736,728 (GRCm39) missense probably damaging 1.00
R6117:Myo10 UTSW 15 25,805,745 (GRCm39) missense probably benign 0.00
R6185:Myo10 UTSW 15 25,726,596 (GRCm39) missense probably damaging 0.99
R6749:Myo10 UTSW 15 25,714,196 (GRCm39) missense probably damaging 1.00
R6819:Myo10 UTSW 15 25,781,496 (GRCm39) missense possibly damaging 0.80
R6875:Myo10 UTSW 15 25,805,745 (GRCm39) missense probably benign 0.00
R6908:Myo10 UTSW 15 25,804,469 (GRCm39) missense probably damaging 1.00
R6963:Myo10 UTSW 15 25,734,149 (GRCm39) missense probably benign 0.31
R7144:Myo10 UTSW 15 25,724,011 (GRCm39) missense probably damaging 1.00
R7266:Myo10 UTSW 15 25,783,067 (GRCm39) missense probably damaging 1.00
R7380:Myo10 UTSW 15 25,779,706 (GRCm39) missense probably benign 0.01
R7460:Myo10 UTSW 15 25,807,913 (GRCm39) missense probably damaging 1.00
R7614:Myo10 UTSW 15 25,701,709 (GRCm39) missense probably benign 0.00
R7618:Myo10 UTSW 15 25,726,561 (GRCm39) nonsense probably null
R7811:Myo10 UTSW 15 25,804,610 (GRCm39) missense probably damaging 1.00
R7830:Myo10 UTSW 15 25,738,057 (GRCm39) nonsense probably null
R7862:Myo10 UTSW 15 25,666,522 (GRCm39) missense probably damaging 1.00
R8232:Myo10 UTSW 15 25,804,400 (GRCm39) missense possibly damaging 0.89
R8264:Myo10 UTSW 15 25,800,195 (GRCm39) missense probably damaging 0.99
R8377:Myo10 UTSW 15 25,804,481 (GRCm39) missense possibly damaging 0.94
R8385:Myo10 UTSW 15 25,804,484 (GRCm39) missense probably damaging 1.00
R8426:Myo10 UTSW 15 25,799,576 (GRCm39) missense probably damaging 0.99
R8439:Myo10 UTSW 15 25,725,158 (GRCm39) missense probably benign 0.00
R8696:Myo10 UTSW 15 25,799,572 (GRCm39) missense probably damaging 1.00
R8775:Myo10 UTSW 15 25,800,145 (GRCm39) missense probably damaging 0.97
R8775-TAIL:Myo10 UTSW 15 25,800,145 (GRCm39) missense probably damaging 0.97
R8970:Myo10 UTSW 15 25,803,467 (GRCm39) missense possibly damaging 0.82
R9024:Myo10 UTSW 15 25,793,295 (GRCm39) missense possibly damaging 0.53
R9196:Myo10 UTSW 15 25,805,716 (GRCm39) missense probably damaging 0.96
R9224:Myo10 UTSW 15 25,808,081 (GRCm39) missense probably benign 0.33
R9308:Myo10 UTSW 15 25,781,862 (GRCm39) missense probably damaging 0.99
R9358:Myo10 UTSW 15 25,781,520 (GRCm39) missense possibly damaging 0.69
R9606:Myo10 UTSW 15 25,776,401 (GRCm39) frame shift probably null
R9722:Myo10 UTSW 15 25,801,227 (GRCm39) missense probably damaging 1.00
RF013:Myo10 UTSW 15 25,799,565 (GRCm39) missense probably damaging 0.99
Z1177:Myo10 UTSW 15 25,799,640 (GRCm39) critical splice donor site probably null
Z1177:Myo10 UTSW 15 25,781,487 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGTGTGGCCATCTACTG -3'
(R):5'- GTCTAGTCTCTTGTAAGGAAAGCAC -3'

Sequencing Primer
(F):5'- CAGTGGTTATGCATCAGTGT -3'
(R):5'- TCTCTTGTAAGGAAAGCACTGAAG -3'
Posted On 2019-11-12