Incidental Mutation 'R7717:Cthrc1'
ID594996
Institutional Source Beutler Lab
Gene Symbol Cthrc1
Ensembl Gene ENSMUSG00000054196
Gene Namecollagen triple helix repeat containing 1
Synonyms1110014B07Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7717 (G1)
Quality Score156.008
Status Not validated
Chromosome15
Chromosomal Location39076932-39087121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39077116 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 38 (V38A)
Ref Sequence ENSEMBL: ENSMUSP00000070018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067072] [ENSMUST00000226433]
Predicted Effect probably benign
Transcript: ENSMUST00000067072
AA Change: V38A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070018
Gene: ENSMUSG00000054196
AA Change: V38A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect
Predicted Effect probably benign
Transcript: ENSMUST00000226433
AA Change: V38A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a protein that may play a role in the cellular response to arterial injury through involvement in vascular remodeling. Mutations at this locus have been associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
PHENOTYPE: Adult mice homozygous for a null allele exhibit decreased bone, decreased osteoblast number and decreased bone formation. Mice homozygous for a different knock-out allele exhibit increased hepatocyte size, decreased cell density in the liver, hepatic steatosis and increased glycogen storage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Cthrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Cthrc1 APN 15 39080499 missense possibly damaging 0.95
IGL02532:Cthrc1 APN 15 39077165 splice site probably benign
IGL02954:Cthrc1 APN 15 39076994 utr 5 prime probably benign
IGL03390:Cthrc1 APN 15 39077134 missense probably benign 0.00
R0390:Cthrc1 UTSW 15 39086764 makesense probably null
R0594:Cthrc1 UTSW 15 39077142 missense possibly damaging 0.95
R1491:Cthrc1 UTSW 15 39086677 missense probably damaging 1.00
R4454:Cthrc1 UTSW 15 39077013 missense probably benign 0.18
R5096:Cthrc1 UTSW 15 39084420 missense probably damaging 0.99
R5860:Cthrc1 UTSW 15 39086685 missense probably damaging 1.00
R7082:Cthrc1 UTSW 15 39077100 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAGTGAAAGGCGCATTGATG -3'
(R):5'- AAGCTTCTTAACGTGCTGCCC -3'

Sequencing Primer
(F):5'- CATTGATGCGGCAGGCTG -3'
(R):5'- AACGTGCTGCCCTACACTC -3'
Posted On2019-11-12