Mutagenetix > Incidental Mutations

Incidental Mutation 'R7717:Cfap44'

594999

Institutional Source

Beutler Lab

Gene Symbol

Cfap44

Ensembl Gene

ENSMUSG00000071550

Gene Name

cilia and flagella associated protein 44

Synonyms

6330444M21Rik, D16Ertd642e, Wdr52

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7717 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

44394796-44482428 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44429935 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 792 (D792G)

Ref Sequence

ENSEMBL: ENSMUSP00000097331 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099742] [ENSMUST00000120049]

AlphaFold

E9Q5M6

Predicted Effect

probably damaging
Transcript: ENSMUST00000099742
AA Change: D792G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000097331
Gene: ENSMUSG00000071550
AA Change: D792G

Domain	Start	End	E-Value	Type
low complexity region	42	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
Blast:WD40	161	201	1e-7	BLAST
WD40	204	246	4.58e1	SMART
WD40	249	288	4.62e-1	SMART
Blast:WD40	292	337	2e-15	BLAST
WD40	342	381	4.8e-2	SMART
WD40	447	486	4.95e-4	SMART
WD40	491	532	2.64e2	SMART
WD40	552	591	2.98e-7	SMART
Blast:WD40	595	634	1e-19	BLAST
coiled coil region	669	711	N/A	INTRINSIC
WD40	780	820	3.82e1	SMART
WD40	830	872	2.4e-2	SMART
coiled coil region	907	955	N/A	INTRINSIC
coiled coil region	1101	1122	N/A	INTRINSIC
low complexity region	1266	1295	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
coiled coil region	1402	1459	N/A	INTRINSIC
low complexity region	1476	1488	N/A	INTRINSIC
low complexity region	1489	1523	N/A	INTRINSIC
coiled coil region	1543	1607	N/A	INTRINSIC
coiled coil region	1630	1731	N/A	INTRINSIC
coiled coil region	1795	1822	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000120049
AA Change: D792G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113908
Gene: ENSMUSG00000071550
AA Change: D792G

Domain	Start	End	E-Value	Type
low complexity region	42	64	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
Blast:WD40	161	201	1e-7	BLAST
WD40	204	246	4.58e1	SMART
WD40	249	288	4.62e-1	SMART
Blast:WD40	292	337	2e-15	BLAST
WD40	342	381	4.8e-2	SMART
WD40	447	486	4.95e-4	SMART
WD40	491	532	2.64e2	SMART
WD40	552	591	2.98e-7	SMART
Blast:WD40	595	634	1e-19	BLAST
coiled coil region	669	711	N/A	INTRINSIC
WD40	780	820	3.82e1	SMART
WD40	830	872	2.4e-2	SMART
coiled coil region	907	955	N/A	INTRINSIC
coiled coil region	1101	1122	N/A	INTRINSIC
low complexity region	1266	1295	N/A	INTRINSIC
low complexity region	1312	1325	N/A	INTRINSIC
coiled coil region	1402	1459	N/A	INTRINSIC
low complexity region	1476	1488	N/A	INTRINSIC
low complexity region	1489	1523	N/A	INTRINSIC
coiled coil region	1543	1607	N/A	INTRINSIC
coiled coil region	1630	1731	N/A	INTRINSIC
coiled coil region	1795	1822	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by multiple sperm axonemal defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,606,757	C408G	probably benign	Het
Adgrf5	T	C	17: 43,450,753	L1113P	probably damaging	Het
Aldh3b3	T	C	19: 3,963,970	L57P	probably damaging	Het
Asb15	A	G	6: 24,559,252	D132G	probably benign	Het
Cep290	C	T	10: 100,492,681	R111W	probably benign	Het
Col20a1	C	T	2: 181,007,615	R1029W	probably damaging	Het
Csf3r	A	G	4: 126,037,610	Y462C	probably damaging	Het
Cthrc1	T	C	15: 39,077,116	V38A	probably benign	Het
Cxcr2	T	C	1: 74,158,839	V164A	probably benign	Het
D230025D16Rik	C	A	8: 105,251,604	Q397K	probably benign	Het
Efr3b	A	G	12: 3,984,574	S199P	probably damaging	Het
Elavl4	A	G	4: 110,206,466	C342R	probably damaging	Het
Gemin5	A	T	11: 58,151,530		probably null	Het
Gm14190	A	T	11: 99,690,650	C31S	unknown	Het
Golt1b	T	A	6: 142,394,043	V78D	probably damaging	Het
Gsdmc3	T	A	15: 63,869,212	D29V	probably damaging	Het
Itih1	T	A	14: 30,931,185	D766V	probably damaging	Het
Larp1b	C	T	3: 40,972,444	S251F	probably damaging	Het
Lrp8	A	G	4: 107,834,743	T115A	probably benign	Het
Lrrc37a	A	G	11: 103,504,300	S100P	probably benign	Het
Lss	T	C	10: 76,545,452	V424A	possibly damaging	Het
Ltbp1	T	C	17: 75,290,078	V568A	possibly damaging	Het
Myo10	A	T	15: 25,731,970	T311S	probably benign	Het
Nsd3	T	C	8: 25,682,562	V779A	probably benign	Het
Olfr1335	A	T	4: 118,808,933	S310R	probably damaging	Het
Olfr138	C	A	17: 38,275,580	Q270K	probably damaging	Het
Olfr1444	A	T	19: 12,861,795	I7F	probably benign	Het
Olfr624	T	C	7: 103,670,945	T29A	probably benign	Het
Olfr698	A	G	7: 106,752,636	W251R	possibly damaging	Het
Olfr748	T	A	14: 50,710,762	L144Q	probably damaging	Het
Pak1	T	A	7: 97,886,348	D215E	probably benign	Het
Pde7b	A	G	10: 20,407,191	F355L	probably benign	Het
Pi4ka	A	G	16: 17,376,923	S204P		Het
Pirb	T	C	7: 3,717,783	K239E	not run	Het
Pirb	C	T	7: 3,717,801	G233R	not run	Het
Pnp	G	A	14: 50,951,003	M211I	probably benign	Het
Pot1a	A	T	6: 25,758,823	L319Q	probably benign	Het
Rspry1	G	T	8: 94,623,122	C46F	probably damaging	Het
Sec11c	C	T	18: 65,812,712	T82M	possibly damaging	Het
Secisbp2	T	C	13: 51,673,098	V414A	probably benign	Het
Tenm2	A	G	11: 36,864,935	F79L	probably damaging	Het
Vmn2r2	A	G	3: 64,134,598	V232A	possibly damaging	Het
Zbtb17	T	C	4: 141,466,083	S593P	probably damaging	Het
Zfp143	T	G	7: 110,086,220	C419G	possibly damaging	Het
Zfp804b	T	C	5: 6,771,293	N590S	possibly damaging	Het

Other mutations in Cfap44

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Cfap44	APN	16	44407404	missense	probably damaging	0.99
IGL00952:Cfap44	APN	16	44421275	missense	probably benign	0.33
IGL01340:Cfap44	APN	16	44404130	missense	probably damaging	1.00
IGL01530:Cfap44	APN	16	44449167	missense	probably damaging	1.00
IGL02083:Cfap44	APN	16	44437162	missense	probably damaging	1.00
IGL02088:Cfap44	APN	16	44451628	missense	possibly damaging	0.59
IGL02142:Cfap44	APN	16	44421144	missense	probably benign	0.15
IGL02311:Cfap44	APN	16	44404771	splice site	probably benign
IGL02574:Cfap44	APN	16	44481383	missense	probably damaging	1.00
IGL02893:Cfap44	APN	16	44416817	missense	probably damaging	1.00
IGL02959:Cfap44	APN	16	44470867	splice site	probably benign
IGL03291:Cfap44	APN	16	44407311	missense	possibly damaging	0.86
feldgrau	UTSW	16	44433666	nonsense	probably null
I2288:Cfap44	UTSW	16	44449138	nonsense	probably null
R0023:Cfap44	UTSW	16	44421220	missense	probably benign	0.01
R0023:Cfap44	UTSW	16	44421220	missense	probably benign	0.01
R0036:Cfap44	UTSW	16	44439069	missense	possibly damaging	0.83
R0139:Cfap44	UTSW	16	44433422	missense	possibly damaging	0.90
R0145:Cfap44	UTSW	16	44468372	missense	probably damaging	1.00
R0193:Cfap44	UTSW	16	44449210	splice site	probably null
R0238:Cfap44	UTSW	16	44422318	missense	probably benign
R0238:Cfap44	UTSW	16	44422318	missense	probably benign
R0288:Cfap44	UTSW	16	44415894	splice site	probably benign
R0367:Cfap44	UTSW	16	44433476	critical splice donor site	probably null
R0452:Cfap44	UTSW	16	44431945	missense	probably benign	0.01
R0531:Cfap44	UTSW	16	44401426	start codon destroyed	probably benign	0.01
R0722:Cfap44	UTSW	16	44404676	missense	possibly damaging	0.94
R0801:Cfap44	UTSW	16	44422486	missense	probably benign	0.41
R1209:Cfap44	UTSW	16	44422417	missense	possibly damaging	0.86
R1215:Cfap44	UTSW	16	44419303	missense	probably damaging	1.00
R1385:Cfap44	UTSW	16	44470775	missense	probably damaging	1.00
R1400:Cfap44	UTSW	16	44421212	missense	probably benign	0.01
R1415:Cfap44	UTSW	16	44481389	missense	probably damaging	0.99
R1475:Cfap44	UTSW	16	44433812	splice site	probably benign
R1901:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R1902:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R1903:Cfap44	UTSW	16	44422374	missense	probably benign	0.00
R2023:Cfap44	UTSW	16	44416012	missense	probably benign	0.01
R2126:Cfap44	UTSW	16	44410475	missense	probably benign	0.40
R2147:Cfap44	UTSW	16	44451684	missense	probably benign	0.31
R2233:Cfap44	UTSW	16	44451525	missense	probably benign	0.01
R2439:Cfap44	UTSW	16	44481246	unclassified	probably benign
R3015:Cfap44	UTSW	16	44410469	missense	probably benign	0.40
R4178:Cfap44	UTSW	16	44451853	missense	possibly damaging	0.81
R4421:Cfap44	UTSW	16	44422437	missense	probably damaging	1.00
R4516:Cfap44	UTSW	16	44473864	nonsense	probably null
R4742:Cfap44	UTSW	16	44449252	splice site	probably null
R4766:Cfap44	UTSW	16	44415883	splice site	probably null
R4810:Cfap44	UTSW	16	44451535	missense	probably damaging	0.99
R4955:Cfap44	UTSW	16	44475277	missense	possibly damaging	0.75
R5058:Cfap44	UTSW	16	44420204	splice site	probably null
R5164:Cfap44	UTSW	16	44481389	missense	probably damaging	0.99
R5172:Cfap44	UTSW	16	44449193	missense	probably benign
R5344:Cfap44	UTSW	16	44416400	critical splice donor site	probably null
R5519:Cfap44	UTSW	16	44404088	missense	probably damaging	1.00
R5572:Cfap44	UTSW	16	44481305	missense	possibly damaging	0.95
R5601:Cfap44	UTSW	16	44460186	missense	probably damaging	1.00
R5625:Cfap44	UTSW	16	44460347	splice site	probably null
R5638:Cfap44	UTSW	16	44455531	missense	possibly damaging	0.94
R5727:Cfap44	UTSW	16	44435442	missense	probably damaging	0.98
R5950:Cfap44	UTSW	16	44479847	missense	probably damaging	0.99
R6057:Cfap44	UTSW	16	44449097	missense	probably benign	0.03
R6063:Cfap44	UTSW	16	44429892	missense	probably benign	0.00
R6221:Cfap44	UTSW	16	44437186	missense	probably benign	0.13
R6277:Cfap44	UTSW	16	44437306	missense	probably benign	0.04
R6322:Cfap44	UTSW	16	44433666	nonsense	probably null
R6836:Cfap44	UTSW	16	44404079	missense	probably damaging	0.99
R6854:Cfap44	UTSW	16	44449028	critical splice acceptor site	probably null
R6889:Cfap44	UTSW	16	44404132	missense	probably benign	0.03
R7233:Cfap44	UTSW	16	44422408	missense	probably damaging	0.99
R7294:Cfap44	UTSW	16	44404893	intron	probably benign
R7298:Cfap44	UTSW	16	44481412	missense	probably benign	0.04
R7332:Cfap44	UTSW	16	44429828	missense	probably damaging	1.00
R7410:Cfap44	UTSW	16	44468413	missense	probably damaging	1.00
R7455:Cfap44	UTSW	16	44404784	intron	probably benign
R7456:Cfap44	UTSW	16	44431942	missense	probably benign	0.07
R7491:Cfap44	UTSW	16	44470748	missense	probably damaging	1.00
R7587:Cfap44	UTSW	16	44404106	missense	probably benign	0.02
R7698:Cfap44	UTSW	16	44433786	missense	probably damaging	0.99
R7953:Cfap44	UTSW	16	44413691	missense	probably benign	0.00
R7994:Cfap44	UTSW	16	44432138	missense	probably damaging	0.97
R8043:Cfap44	UTSW	16	44413691	missense	probably benign	0.00
R8238:Cfap44	UTSW	16	44415305	splice site	probably null
R8338:Cfap44	UTSW	16	44419335	critical splice donor site	probably null
R8678:Cfap44	UTSW	16	44475273	missense	probably damaging	1.00
R8680:Cfap44	UTSW	16	44404722	missense	probably damaging	0.98
R8785:Cfap44	UTSW	16	44455532	missense	probably damaging	0.99
R8922:Cfap44	UTSW	16	44451667	missense	probably benign	0.23
R9005:Cfap44	UTSW	16	44460154	missense	probably damaging	1.00
R9020:Cfap44	UTSW	16	44437159	missense	probably damaging	0.99
R9110:Cfap44	UTSW	16	44435560	missense	probably damaging	0.98
R9111:Cfap44	UTSW	16	44431963	missense	probably benign	0.00
R9126:Cfap44	UTSW	16	44475256	missense	possibly damaging	0.77
R9194:Cfap44	UTSW	16	44468461	missense	probably damaging	1.00
R9251:Cfap44	UTSW	16	44408913	missense	probably damaging	0.99
R9334:Cfap44	UTSW	16	44419291	missense	probably damaging	0.98
R9336:Cfap44	UTSW	16	44422444	missense	probably damaging	0.97
V1662:Cfap44	UTSW	16	44449138	nonsense	probably null
X0060:Cfap44	UTSW	16	44449074	missense	possibly damaging	0.83
Z1088:Cfap44	UTSW	16	44401466	missense	probably damaging	0.98
Z1177:Cfap44	UTSW	16	44432044	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- AGGAATGAGGTGCGTACTGC -3'
(R):5'- AGAATTTCAAGACTAGGTCTCGC -3'

Sequencing Primer
(F):5'- GCGTACTGCGTTCACAAATC -3'
(R):5'- CCTGAAAGGGTCTAGTATCTCCAG -3'

Posted On

2019-11-12