Incidental Mutation 'R7717:Olfr138'
ID 595000
Institutional Source Beutler Lab
Gene Symbol Olfr138
Ensembl Gene ENSMUSG00000057443
Gene Name olfactory receptor 138
Synonyms GA_x6K02T2PSCP-2718585-2719523, MOR256-40P, Olfr89
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 38261035-38276410 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 38275580 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Lysine at position 270 (Q270K)
Ref Sequence ENSEMBL: ENSMUSP00000133828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071871] [ENSMUST00000172843] [ENSMUST00000173841]
AlphaFold Q7TRI7
Predicted Effect probably damaging
Transcript: ENSMUST00000071871
AA Change: Q270K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071767
Gene: ENSMUSG00000057443
AA Change: Q270K

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-33 PFAM
Pfam:7tm_4 139 283 8.1e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172843
AA Change: Q270K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133698
Gene: ENSMUSG00000057443
AA Change: Q270K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.5e-46 PFAM
Pfam:7tm_1 41 290 1.9e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173841
AA Change: Q270K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133828
Gene: ENSMUSG00000057443
AA Change: Q270K

DomainStartEndE-ValueType
Pfam:7tm_1 41 123 1.7e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Olfr138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Olfr138 APN 17 38274899 missense probably benign 0.01
IGL01874:Olfr138 APN 17 38275517 missense probably benign 0.32
IGL02209:Olfr138 APN 17 38275232 missense probably benign 0.00
IGL03053:Olfr138 APN 17 38274791 missense probably damaging 0.96
IGL03168:Olfr138 APN 17 38274791 missense probably damaging 0.96
R0393:Olfr138 UTSW 17 38274883 missense probably benign 0.00
R0667:Olfr138 UTSW 17 38275157 missense probably damaging 1.00
R1288:Olfr138 UTSW 17 38275223 missense probably benign 0.09
R1567:Olfr138 UTSW 17 38275568 missense possibly damaging 0.87
R1618:Olfr138 UTSW 17 38275666 splice site probably null
R1699:Olfr138 UTSW 17 38275041 missense probably benign 0.39
R1748:Olfr138 UTSW 17 38275106 missense possibly damaging 0.50
R1862:Olfr138 UTSW 17 38275344 missense probably damaging 0.99
R2251:Olfr138 UTSW 17 38274903 missense probably benign 0.01
R3436:Olfr138 UTSW 17 38275530 missense probably damaging 1.00
R4731:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R4732:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R4733:Olfr138 UTSW 17 38275547 missense probably damaging 1.00
R5404:Olfr138 UTSW 17 38275626 nonsense probably null
R5443:Olfr138 UTSW 17 38275014 missense probably damaging 0.99
R5683:Olfr138 UTSW 17 38275546 missense possibly damaging 0.69
R6058:Olfr138 UTSW 17 38275259 missense probably damaging 0.99
R6061:Olfr138 UTSW 17 38274881 missense probably benign
R6266:Olfr138 UTSW 17 38275148 missense probably benign 0.22
R7520:Olfr138 UTSW 17 38275440 missense probably benign 0.00
R7959:Olfr138 UTSW 17 38275711 makesense probably null
R8256:Olfr138 UTSW 17 38275520 missense probably damaging 0.99
R9241:Olfr138 UTSW 17 38274890 missense probably benign 0.00
X0024:Olfr138 UTSW 17 38275445 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGAGCTAGCACTTTCTGTGG -3'
(R):5'- CAGAAACGTTTTCAGACTGTTCTTC -3'

Sequencing Primer
(F):5'- ATTGTTCCTCTGTGCTTAATTCTTG -3'
(R):5'- TTCATAAACATAACCCACACTGTTG -3'
Posted On 2019-11-12