Mutagenetix > Incidental Mutation

Incidental Mutation 'R7717:Adgrf5'

595001

Institutional Source

Beutler Lab

Gene Symbol

Adgrf5

Ensembl Gene

ENSMUSG00000056492

Gene Name

adhesion G protein-coupled receptor F5

Synonyms

Gpr116, 8430401C09Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7717 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43360451-43459557 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43450753 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1113 (L1113P)

Ref Sequence

ENSEMBL: ENSMUSP00000109229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113599] [ENSMUST00000225962] [ENSMUST00000226087]

AlphaFold

G5E8Q8

Predicted Effect

probably damaging
Transcript: ENSMUST00000113599
AA Change: L1113P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109229
Gene: ENSMUSG00000056492
AA Change: L1113P

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Blast:EGF	118	161	8e-14	BLAST
Pfam:SEA	165	263	9.2e-14	PFAM
IG	276	366	1.54e-4	SMART
Blast:IG_like	374	464	2e-31	BLAST
IG	475	561	1.04e-1	SMART
low complexity region	815	823	N/A	INTRINSIC
GPS	949	1004	6.49e-16	SMART
Pfam:7tm_2	1011	1264	1.2e-35	PFAM
low complexity region	1328	1347	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000225962
AA Change: L908P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000226087
AA Change: L1113P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.2%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased body weight and respiratory distress associated with pulmonary alveolar proteinosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	C	11: 23,606,757	C408G	probably benign	Het
Aldh3b3	T	C	19: 3,963,970	L57P	probably damaging	Het
Asb15	A	G	6: 24,559,252	D132G	probably benign	Het
Cep290	C	T	10: 100,492,681	R111W	probably benign	Het
Cfap44	A	G	16: 44,429,935	D792G	probably damaging	Het
Col20a1	C	T	2: 181,007,615	R1029W	probably damaging	Het
Csf3r	A	G	4: 126,037,610	Y462C	probably damaging	Het
Cthrc1	T	C	15: 39,077,116	V38A	probably benign	Het
Cxcr2	T	C	1: 74,158,839	V164A	probably benign	Het
D230025D16Rik	C	A	8: 105,251,604	Q397K	probably benign	Het
Efr3b	A	G	12: 3,984,574	S199P	probably damaging	Het
Elavl4	A	G	4: 110,206,466	C342R	probably damaging	Het
Gemin5	A	T	11: 58,151,530		probably null	Het
Gm14190	A	T	11: 99,690,650	C31S	unknown	Het
Golt1b	T	A	6: 142,394,043	V78D	probably damaging	Het
Gsdmc3	T	A	15: 63,869,212	D29V	probably damaging	Het
Itih1	T	A	14: 30,931,185	D766V	probably damaging	Het
Larp1b	C	T	3: 40,972,444	S251F	probably damaging	Het
Lrp8	A	G	4: 107,834,743	T115A	probably benign	Het
Lrrc37a	A	G	11: 103,504,300	S100P	probably benign	Het
Lss	T	C	10: 76,545,452	V424A	possibly damaging	Het
Ltbp1	T	C	17: 75,290,078	V568A	possibly damaging	Het
Myo10	A	T	15: 25,731,970	T311S	probably benign	Het
Nsd3	T	C	8: 25,682,562	V779A	probably benign	Het
Olfr1335	A	T	4: 118,808,933	S310R	probably damaging	Het
Olfr138	C	A	17: 38,275,580	Q270K	probably damaging	Het
Olfr1444	A	T	19: 12,861,795	I7F	probably benign	Het
Olfr624	T	C	7: 103,670,945	T29A	probably benign	Het
Olfr698	A	G	7: 106,752,636	W251R	possibly damaging	Het
Olfr748	T	A	14: 50,710,762	L144Q	probably damaging	Het
Pak1	T	A	7: 97,886,348	D215E	probably benign	Het
Pde7b	A	G	10: 20,407,191	F355L	probably benign	Het
Pi4ka	A	G	16: 17,376,923	S204P		Het
Pirb	T	C	7: 3,717,783	K239E	not run	Het
Pirb	C	T	7: 3,717,801	G233R	not run	Het
Pnp	G	A	14: 50,951,003	M211I	probably benign	Het
Pot1a	A	T	6: 25,758,823	L319Q	probably benign	Het
Rspry1	G	T	8: 94,623,122	C46F	probably damaging	Het
Sec11c	C	T	18: 65,812,712	T82M	possibly damaging	Het
Secisbp2	T	C	13: 51,673,098	V414A	probably benign	Het
Tenm2	A	G	11: 36,864,935	F79L	probably damaging	Het
Vmn2r2	A	G	3: 64,134,598	V232A	possibly damaging	Het
Zbtb17	T	C	4: 141,466,083	S593P	probably damaging	Het
Zfp143	T	G	7: 110,086,220	C419G	possibly damaging	Het
Zfp804b	T	C	5: 6,771,293	N590S	possibly damaging	Het

Other mutations in Adgrf5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00501:Adgrf5	APN	17	43449915	missense	possibly damaging	0.79
IGL00590:Adgrf5	APN	17	43453147	missense	probably damaging	1.00
IGL01128:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01131:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01132:Adgrf5	APN	17	43422509	missense	possibly damaging	0.95
IGL01392:Adgrf5	APN	17	43450012	missense	probably benign	0.00
IGL01475:Adgrf5	APN	17	43450354	missense	probably benign	0.00
IGL01614:Adgrf5	APN	17	43424471	missense	possibly damaging	0.53
IGL01654:Adgrf5	APN	17	43451170	missense	possibly damaging	0.89
IGL02053:Adgrf5	APN	17	43450167	missense	possibly damaging	0.47
IGL02175:Adgrf5	APN	17	43451010	missense	probably damaging	1.00
IGL02416:Adgrf5	APN	17	43444980	splice site	probably null
IGL02525:Adgrf5	APN	17	43449963	missense	probably damaging	1.00
IGL03035:Adgrf5	APN	17	43430627	missense	possibly damaging	0.80
duct_tape	UTSW	17	43445115	missense	probably benign	0.04
Flypaper	UTSW	17	43422661	splice site	probably benign
goop	UTSW	17	43441969	missense	probably damaging	0.99
Heaped	UTSW	17	43447036	missense	possibly damaging	0.93
la_brea	UTSW	17	43452323	critical splice donor site	probably null
Motel	UTSW	17	43450380	missense	probably damaging	1.00
noel	UTSW	17	43430612	missense	probably damaging	1.00
Schmutzfinger	UTSW	17	43424818	nonsense	probably null
sticky	UTSW	17	43437571	missense	probably damaging	0.98
sweetie	UTSW	17	43450983	missense	probably damaging	0.96
PIT4812001:Adgrf5	UTSW	17	43450369	missense	probably damaging	1.00
R0699:Adgrf5	UTSW	17	43422661	splice site	probably null
R0972:Adgrf5	UTSW	17	43450983	missense	probably damaging	0.96
R1521:Adgrf5	UTSW	17	43430552	missense	probably benign	0.03
R1523:Adgrf5	UTSW	17	43450153	missense	probably benign	0.00
R1758:Adgrf5	UTSW	17	43424593	critical splice donor site	probably null
R1767:Adgrf5	UTSW	17	43450564	missense	possibly damaging	0.87
R1799:Adgrf5	UTSW	17	43440067	missense	probably damaging	0.98
R1800:Adgrf5	UTSW	17	43451082	missense	probably damaging	1.00
R1888:Adgrf5	UTSW	17	43427005	splice site	probably null
R1888:Adgrf5	UTSW	17	43427005	splice site	probably null
R2057:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2058:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2059:Adgrf5	UTSW	17	43428586	missense	possibly damaging	0.88
R2410:Adgrf5	UTSW	17	43455266	missense	probably benign	0.11
R2568:Adgrf5	UTSW	17	43437671	missense	probably damaging	1.00
R2847:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R2848:Adgrf5	UTSW	17	43422640	missense	possibly damaging	0.69
R3800:Adgrf5	UTSW	17	43447060	splice site	probably benign
R3856:Adgrf5	UTSW	17	43447036	missense	possibly damaging	0.93
R4021:Adgrf5	UTSW	17	43430714	splice site	probably benign
R4075:Adgrf5	UTSW	17	43450195	missense	probably damaging	1.00
R4366:Adgrf5	UTSW	17	43441969	missense	probably damaging	0.99
R4409:Adgrf5	UTSW	17	43441847	missense	probably damaging	1.00
R4570:Adgrf5	UTSW	17	43445115	missense	probably benign	0.04
R4616:Adgrf5	UTSW	17	43452440	missense	probably benign	0.38
R4623:Adgrf5	UTSW	17	43450983	missense	probably benign	0.16
R4645:Adgrf5	UTSW	17	43437525	missense	probably damaging	1.00
R5211:Adgrf5	UTSW	17	43422620	missense	probably benign	0.32
R5268:Adgrf5	UTSW	17	43450999	missense	probably damaging	1.00
R5280:Adgrf5	UTSW	17	43426334	missense	probably damaging	1.00
R5326:Adgrf5	UTSW	17	43440074	missense	probably damaging	0.98
R5762:Adgrf5	UTSW	17	43430695	missense	probably null	0.16
R5856:Adgrf5	UTSW	17	43446120	missense	probably benign	0.09
R6007:Adgrf5	UTSW	17	43437571	missense	probably damaging	0.98
R6153:Adgrf5	UTSW	17	43451083	missense	possibly damaging	0.96
R6451:Adgrf5	UTSW	17	43424818	nonsense	probably null
R6535:Adgrf5	UTSW	17	43440029	missense	probably benign	0.05
R6536:Adgrf5	UTSW	17	43422661	splice site	probably benign
R6602:Adgrf5	UTSW	17	43450304	missense	probably benign	0.32
R6882:Adgrf5	UTSW	17	43450380	missense	probably damaging	1.00
R6992:Adgrf5	UTSW	17	43452323	critical splice donor site	probably null
R7137:Adgrf5	UTSW	17	43450897	missense	probably damaging	1.00
R7170:Adgrf5	UTSW	17	43446138	missense	possibly damaging	0.92
R7313:Adgrf5	UTSW	17	43445083	missense	probably benign	0.01
R7313:Adgrf5	UTSW	17	43452477	critical splice donor site	probably null
R7331:Adgrf5	UTSW	17	43437593	missense	probably damaging	0.99
R7346:Adgrf5	UTSW	17	43451179	missense	probably damaging	1.00
R7350:Adgrf5	UTSW	17	43428444	critical splice acceptor site	probably null
R7667:Adgrf5	UTSW	17	43446039	missense	probably benign	0.01
R7731:Adgrf5	UTSW	17	43450560	missense	probably damaging	1.00
R7877:Adgrf5	UTSW	17	43441838	missense	possibly damaging	0.63
R7950:Adgrf5	UTSW	17	43451157	missense	probably damaging	0.99
R7988:Adgrf5	UTSW	17	43439813	intron	probably benign
R8188:Adgrf5	UTSW	17	43430612	missense	probably damaging	1.00
R8219:Adgrf5	UTSW	17	43449859	missense	probably benign	0.13
R8284:Adgrf5	UTSW	17	43455270	missense	unknown
R8460:Adgrf5	UTSW	17	43439808	intron	probably benign
R8504:Adgrf5	UTSW	17	43446949	missense	probably benign	0.01
R8751:Adgrf5	UTSW	17	43437683	missense	possibly damaging	0.80
R8852:Adgrf5	UTSW	17	43453098	missense	possibly damaging	0.82
R9196:Adgrf5	UTSW	17	43445104	missense	possibly damaging	0.94
R9418:Adgrf5	UTSW	17	43426973	missense	probably benign	0.00
R9671:Adgrf5	UTSW	17	43449904	missense	probably damaging	1.00
R9734:Adgrf5	UTSW	17	43452308	missense	probably damaging	1.00
R9756:Adgrf5	UTSW	17	43450246	missense	probably benign	0.01
R9765:Adgrf5	UTSW	17	43437600	missense	probably damaging	1.00
X0017:Adgrf5	UTSW	17	43427045	missense	probably damaging	1.00
Z1177:Adgrf5	UTSW	17	43445053	missense	probably benign	0.00
Z1191:Adgrf5	UTSW	17	43445035	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- ATGCGCCACATCTGCATAG -3'
(R):5'- ATAATCAACGCGGGGATGGC -3'

Sequencing Primer
(F):5'- GCCACATCTGCATAGTCAACATTG -3'
(R):5'- AAAGCCAGCAGTGCTCTG -3'

Posted On

2019-11-12