Incidental Mutation 'R7717:Sec11c'
ID 595003
Institutional Source Beutler Lab
Gene Symbol Sec11c
Ensembl Gene ENSMUSG00000024516
Gene Name SEC11 homolog C, signal peptidase complex subunit
Synonyms 1810029G24Rik, Sec11l3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 18
Chromosomal Location 65800549-65817665 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 65812712 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 82 (T82M)
Ref Sequence ENSEMBL: ENSMUSP00000025394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025394] [ENSMUST00000126432] [ENSMUST00000153193]
AlphaFold Q9D8V7
Predicted Effect possibly damaging
Transcript: ENSMUST00000025394
AA Change: T82M

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025394
Gene: ENSMUSG00000024516
AA Change: T82M

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:Peptidase_S24 63 135 1.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126432
AA Change: T82M

PolyPhen 2 Score 0.231 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122624
Gene: ENSMUSG00000024516
AA Change: T82M

DomainStartEndE-ValueType
transmembrane domain 34 56 N/A INTRINSIC
Pfam:Peptidase_S24 63 98 6.8e-7 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153193
AA Change: T96M

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122547
Gene: ENSMUSG00000024516
AA Change: T96M

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
SCOP:d1b12a_ 76 98 1e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Aldh3b3 T C 19: 3,963,970 L57P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Sec11c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1912:Sec11c UTSW 18 65814874 missense probably damaging 1.00
R2114:Sec11c UTSW 18 65800649 missense probably benign 0.00
R2115:Sec11c UTSW 18 65800649 missense probably benign 0.00
R2116:Sec11c UTSW 18 65800649 missense probably benign 0.00
R2117:Sec11c UTSW 18 65800649 missense probably benign 0.00
R4869:Sec11c UTSW 18 65801470 missense probably benign 0.00
R7161:Sec11c UTSW 18 65812732 missense probably benign 0.01
R7185:Sec11c UTSW 18 65814892 missense probably damaging 1.00
R8520:Sec11c UTSW 18 65814840 missense probably damaging 0.98
R8977:Sec11c UTSW 18 65812747 missense possibly damaging 0.57
R9398:Sec11c UTSW 18 65809497 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGTCCTCATCTGAGCTGGAG -3'
(R):5'- AAAGTCAGGTCACTGGTGC -3'

Sequencing Primer
(F):5'- CCTCATCTGAGCTGGAGGGAAG -3'
(R):5'- TCACTGGTGCCAAGGAGAC -3'
Posted On 2019-11-12