Incidental Mutation 'R7717:Aldh3b3'
ID595004
Institutional Source Beutler Lab
Gene Symbol Aldh3b3
Ensembl Gene ENSMUSG00000037263
Gene Namealdehyde dehydrogenase 3 family, member B3
Synonyms1700055N04Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R7717 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location3958645-3972103 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3963970 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 57 (L57P)
Ref Sequence ENSEMBL: ENSMUSP00000136334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179433] [ENSMUST00000189124]
Predicted Effect probably benign
Transcript: ENSMUST00000025794
SMART Domains Protein: ENSMUSP00000025794
Gene: ENSMUSG00000037263

DomainStartEndE-ValueType
PDB:4L2O|G 1 87 5e-22 PDB
SCOP:d1ad3a_ 8 82 2e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000179433
AA Change: L57P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136334
Gene: ENSMUSG00000037263
AA Change: L57P

DomainStartEndE-ValueType
Pfam:Aldedh 6 441 5.4e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189124
AA Change: L57P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140893
Gene: ENSMUSG00000037263
AA Change: L57P

DomainStartEndE-ValueType
SCOP:d1ad3a_ 18 72 2e-8 SMART
PDB:1AD3|B 19 67 1e-8 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,606,757 C408G probably benign Het
Adgrf5 T C 17: 43,450,753 L1113P probably damaging Het
Asb15 A G 6: 24,559,252 D132G probably benign Het
Cep290 C T 10: 100,492,681 R111W probably benign Het
Cfap44 A G 16: 44,429,935 D792G probably damaging Het
Col20a1 C T 2: 181,007,615 R1029W probably damaging Het
Csf3r A G 4: 126,037,610 Y462C probably damaging Het
Cthrc1 T C 15: 39,077,116 V38A probably benign Het
Cxcr2 T C 1: 74,158,839 V164A probably benign Het
D230025D16Rik C A 8: 105,251,604 Q397K probably benign Het
Efr3b A G 12: 3,984,574 S199P probably damaging Het
Elavl4 A G 4: 110,206,466 C342R probably damaging Het
Gemin5 A T 11: 58,151,530 probably null Het
Gm14190 A T 11: 99,690,650 C31S unknown Het
Golt1b T A 6: 142,394,043 V78D probably damaging Het
Gsdmc3 T A 15: 63,869,212 D29V probably damaging Het
Itih1 T A 14: 30,931,185 D766V probably damaging Het
Larp1b C T 3: 40,972,444 S251F probably damaging Het
Lrp8 A G 4: 107,834,743 T115A probably benign Het
Lrrc37a A G 11: 103,504,300 S100P probably benign Het
Lss T C 10: 76,545,452 V424A possibly damaging Het
Ltbp1 T C 17: 75,290,078 V568A possibly damaging Het
Myo10 A T 15: 25,731,970 T311S probably benign Het
Nsd3 T C 8: 25,682,562 V779A probably benign Het
Olfr1335 A T 4: 118,808,933 S310R probably damaging Het
Olfr138 C A 17: 38,275,580 Q270K probably damaging Het
Olfr1444 A T 19: 12,861,795 I7F probably benign Het
Olfr624 T C 7: 103,670,945 T29A probably benign Het
Olfr698 A G 7: 106,752,636 W251R possibly damaging Het
Olfr748 T A 14: 50,710,762 L144Q probably damaging Het
Pak1 T A 7: 97,886,348 D215E probably benign Het
Pde7b A G 10: 20,407,191 F355L probably benign Het
Pi4ka A G 16: 17,376,923 S204P Het
Pirb T C 7: 3,717,783 K239E not run Het
Pirb C T 7: 3,717,801 G233R not run Het
Pnp G A 14: 50,951,003 M211I probably benign Het
Pot1a A T 6: 25,758,823 L319Q probably benign Het
Rspry1 G T 8: 94,623,122 C46F probably damaging Het
Sec11c C T 18: 65,812,712 T82M possibly damaging Het
Secisbp2 T C 13: 51,673,098 V414A probably benign Het
Tenm2 A G 11: 36,864,935 F79L probably damaging Het
Vmn2r2 A G 3: 64,134,598 V232A possibly damaging Het
Zbtb17 T C 4: 141,466,083 S593P probably damaging Het
Zfp143 T G 7: 110,086,220 C419G possibly damaging Het
Zfp804b T C 5: 6,771,293 N590S possibly damaging Het
Other mutations in Aldh3b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Aldh3b3 APN 19 3965863 missense probably benign 0.02
R0395:Aldh3b3 UTSW 19 3966472 missense probably benign 0.00
R0762:Aldh3b3 UTSW 19 3965747 splice site probably null
R1722:Aldh3b3 UTSW 19 3964871 missense possibly damaging 0.76
R1754:Aldh3b3 UTSW 19 3968517 missense probably benign
R1853:Aldh3b3 UTSW 19 3965822 missense probably damaging 1.00
R1901:Aldh3b3 UTSW 19 3965130 missense probably damaging 1.00
R3924:Aldh3b3 UTSW 19 3968491 missense probably damaging 1.00
R4578:Aldh3b3 UTSW 19 3964832 missense probably benign
R4689:Aldh3b3 UTSW 19 3964516 missense probably damaging 0.97
R5632:Aldh3b3 UTSW 19 3968522 utr 3 prime probably benign
R5635:Aldh3b3 UTSW 19 3968512 missense probably benign 0.17
R7422:Aldh3b3 UTSW 19 3966476 missense probably benign 0.01
R7478:Aldh3b3 UTSW 19 3964549 missense probably benign 0.36
R7481:Aldh3b3 UTSW 19 3964549 missense probably benign 0.36
R7863:Aldh3b3 UTSW 19 3965322 nonsense probably null
R7868:Aldh3b3 UTSW 19 3968492 nonsense probably null
R7895:Aldh3b3 UTSW 19 3964871 missense possibly damaging 0.76
R8745:Aldh3b3 UTSW 19 3964890 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGAAGGCCACAAGCTTCTG -3'
(R):5'- TTTGGGCACATACCTTGCCG -3'

Sequencing Primer
(F):5'- GTCTTAATGACGGTGTCAGTCTCAAC -3'
(R):5'- GGCACATACCTTGCCGTGTATG -3'
Posted On2019-11-12