Incidental Mutation 'R7717:Or5b21'
ID 595005
Institutional Source Beutler Lab
Gene Symbol Or5b21
Ensembl Gene ENSMUSG00000046272
Gene Name olfactory receptor family 5 subfamily B member 21
Synonyms Olfr1444, GA_x6K02T2RE5P-3191201-3192160, MOR202-4
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.260) question?
Stock # R7717 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 12839141-12840100 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 12839159 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 7 (I7F)
Ref Sequence ENSEMBL: ENSMUSP00000150212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059675] [ENSMUST00000213606]
AlphaFold Q8VFX2
Predicted Effect probably benign
Transcript: ENSMUST00000059675
AA Change: I7F

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000062460
Gene: ENSMUSG00000046272
AA Change: I7F

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.6e-54 PFAM
Pfam:7tm_1 42 291 5.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213606
AA Change: I7F

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 T C 17: 43,761,644 (GRCm39) L1113P probably damaging Het
Aldh3b3 T C 19: 4,013,970 (GRCm39) L57P probably damaging Het
Asb15 A G 6: 24,559,251 (GRCm39) D132G probably benign Het
Cep290 C T 10: 100,328,543 (GRCm39) R111W probably benign Het
Cfap44 A G 16: 44,250,298 (GRCm39) D792G probably damaging Het
Col20a1 C T 2: 180,649,408 (GRCm39) R1029W probably damaging Het
Csf3r A G 4: 125,931,403 (GRCm39) Y462C probably damaging Het
Cthrc1 T C 15: 38,940,511 (GRCm39) V38A probably benign Het
Cxcr2 T C 1: 74,197,998 (GRCm39) V164A probably benign Het
Efr3b A G 12: 4,034,574 (GRCm39) S199P probably damaging Het
Elavl4 A G 4: 110,063,663 (GRCm39) C342R probably damaging Het
Gemin5 A T 11: 58,042,356 (GRCm39) probably null Het
Gm14190 A T 11: 99,581,476 (GRCm39) C31S unknown Het
Golt1b T A 6: 142,339,769 (GRCm39) V78D probably damaging Het
Gsdmc3 T A 15: 63,741,061 (GRCm39) D29V probably damaging Het
Itih1 T A 14: 30,653,142 (GRCm39) D766V probably damaging Het
Larp1b C T 3: 40,926,879 (GRCm39) S251F probably damaging Het
Lrp8 A G 4: 107,691,940 (GRCm39) T115A probably benign Het
Lrrc37a A G 11: 103,395,126 (GRCm39) S100P probably benign Het
Lss T C 10: 76,381,286 (GRCm39) V424A possibly damaging Het
Ltbp1 T C 17: 75,597,073 (GRCm39) V568A possibly damaging Het
Myo10 A T 15: 25,732,056 (GRCm39) T311S probably benign Het
Nsd3 T C 8: 26,172,578 (GRCm39) V779A probably benign Het
Or10ak12 A T 4: 118,666,130 (GRCm39) S310R probably damaging Het
Or11h23 T A 14: 50,948,219 (GRCm39) L144Q probably damaging Het
Or2ag16 A G 7: 106,351,843 (GRCm39) W251R possibly damaging Het
Or2n1e C A 17: 38,586,471 (GRCm39) Q270K probably damaging Het
Or51v8 T C 7: 103,320,152 (GRCm39) T29A probably benign Het
Pak1 T A 7: 97,535,555 (GRCm39) D215E probably benign Het
Pde7b A G 10: 20,282,937 (GRCm39) F355L probably benign Het
Phaf1 C A 8: 105,978,236 (GRCm39) Q397K probably benign Het
Pi4ka A G 16: 17,194,787 (GRCm39) S204P Het
Pirb T C 7: 3,720,782 (GRCm39) K239E not run Het
Pirb C T 7: 3,720,800 (GRCm39) G233R not run Het
Pnp G A 14: 51,188,460 (GRCm39) M211I probably benign Het
Pot1a A T 6: 25,758,822 (GRCm39) L319Q probably benign Het
Rspry1 G T 8: 95,349,750 (GRCm39) C46F probably damaging Het
Sanbr A C 11: 23,556,757 (GRCm39) C408G probably benign Het
Sec11c C T 18: 65,945,783 (GRCm39) T82M possibly damaging Het
Secisbp2 T C 13: 51,827,134 (GRCm39) V414A probably benign Het
Tenm2 A G 11: 36,755,762 (GRCm39) F79L probably damaging Het
Vmn2r2 A G 3: 64,042,019 (GRCm39) V232A possibly damaging Het
Zbtb17 T C 4: 141,193,394 (GRCm39) S593P probably damaging Het
Zfp143 T G 7: 109,685,427 (GRCm39) C419G possibly damaging Het
Zfp804b T C 5: 6,821,293 (GRCm39) N590S possibly damaging Het
Other mutations in Or5b21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:Or5b21 APN 19 12,839,231 (GRCm39) missense probably benign 0.00
IGL01963:Or5b21 APN 19 12,839,746 (GRCm39) missense probably benign 0.00
IGL02030:Or5b21 APN 19 12,839,799 (GRCm39) missense probably benign 0.00
IGL02178:Or5b21 APN 19 12,839,907 (GRCm39) missense possibly damaging 0.49
IGL02641:Or5b21 APN 19 12,839,566 (GRCm39) nonsense probably null
R0311:Or5b21 UTSW 19 12,839,233 (GRCm39) missense probably benign 0.01
R0543:Or5b21 UTSW 19 12,839,252 (GRCm39) missense probably benign 0.00
R0815:Or5b21 UTSW 19 12,840,008 (GRCm39) missense probably benign 0.00
R2034:Or5b21 UTSW 19 12,839,151 (GRCm39) missense possibly damaging 0.82
R2078:Or5b21 UTSW 19 12,839,751 (GRCm39) missense probably benign 0.05
R2431:Or5b21 UTSW 19 12,839,970 (GRCm39) missense probably damaging 1.00
R3032:Or5b21 UTSW 19 12,839,282 (GRCm39) missense probably benign 0.00
R3932:Or5b21 UTSW 19 12,839,994 (GRCm39) missense possibly damaging 0.95
R4498:Or5b21 UTSW 19 12,840,033 (GRCm39) missense probably damaging 1.00
R4654:Or5b21 UTSW 19 12,839,596 (GRCm39) nonsense probably null
R4708:Or5b21 UTSW 19 12,839,261 (GRCm39) missense probably benign 0.00
R4823:Or5b21 UTSW 19 12,839,180 (GRCm39) missense probably benign 0.04
R4938:Or5b21 UTSW 19 12,839,916 (GRCm39) missense probably damaging 1.00
R4980:Or5b21 UTSW 19 12,839,384 (GRCm39) missense probably benign
R5580:Or5b21 UTSW 19 12,839,168 (GRCm39) missense possibly damaging 0.59
R5622:Or5b21 UTSW 19 12,839,663 (GRCm39) missense probably benign 0.08
R5671:Or5b21 UTSW 19 12,839,171 (GRCm39) missense probably benign 0.02
R6149:Or5b21 UTSW 19 12,839,723 (GRCm39) missense probably benign 0.02
R6683:Or5b21 UTSW 19 12,840,014 (GRCm39) missense probably damaging 0.98
R7389:Or5b21 UTSW 19 12,839,981 (GRCm39) missense probably benign 0.04
R7392:Or5b21 UTSW 19 12,839,951 (GRCm39) missense probably benign 0.18
R7461:Or5b21 UTSW 19 12,839,141 (GRCm39) start codon destroyed probably benign 0.00
R7613:Or5b21 UTSW 19 12,839,141 (GRCm39) start codon destroyed probably benign 0.00
R7698:Or5b21 UTSW 19 12,840,077 (GRCm39) missense possibly damaging 0.69
R7892:Or5b21 UTSW 19 12,839,843 (GRCm39) nonsense probably null
R9151:Or5b21 UTSW 19 12,839,976 (GRCm39) missense probably damaging 1.00
R9656:Or5b21 UTSW 19 12,839,247 (GRCm39) missense probably damaging 1.00
Z1088:Or5b21 UTSW 19 12,839,648 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACATCCAGTTTGAACTCAG -3'
(R):5'- AGTATCCCAGATCTACAAAGGACAG -3'

Sequencing Primer
(F):5'- TGACTTTGACCTTTATTAAGCTGTC -3'
(R):5'- TCCCAGATCTACAAAGGACAGGTTAC -3'
Posted On 2019-11-12