Incidental Mutation 'R7718:Orc2'
ID595008
Institutional Source Beutler Lab
Gene Symbol Orc2
Ensembl Gene ENSMUSG00000026037
Gene Nameorigin recognition complex, subunit 2
SynonymsOrc2l
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location58462771-58505109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58480317 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 246 (H246Q)
Ref Sequence ENSEMBL: ENSMUSP00000027198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027198] [ENSMUST00000114325] [ENSMUST00000114337] [ENSMUST00000190695]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027198
AA Change: H246Q

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027198
Gene: ENSMUSG00000026037
AA Change: H246Q

DomainStartEndE-ValueType
low complexity region 176 201 N/A INTRINSIC
Pfam:ORC2 254 563 2.5e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114325
AA Change: H198Q

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109964
Gene: ENSMUSG00000026037
AA Change: H198Q

DomainStartEndE-ValueType
low complexity region 128 153 N/A INTRINSIC
Pfam:ORC2 206 517 1.2e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114337
SMART Domains Protein: ENSMUSP00000109976
Gene: ENSMUSG00000026036

DomainStartEndE-ValueType
Pfam:NIF3 31 324 4e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190695
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. This protein forms a core complex with ORC3, -4, and -5. It also interacts with CDC45 and MCM10, which are proteins known to be important for the initiation of DNA replication. This protein has been demonstrated to specifically associate with the origin of replication of Epstein-Barr virus in human cells, and is thought to be required for DNA replication from viral origin of replication. Alternatively spliced transcript variants have been found, one of which is a nonsense-mediated mRNA decay candidate. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Orc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Orc2 APN 1 58493716 missense possibly damaging 0.81
IGL00549:Orc2 APN 1 58481042 missense probably benign 0.00
IGL01343:Orc2 APN 1 58492855 critical splice donor site probably null
IGL01357:Orc2 APN 1 58497392 missense probably benign 0.26
IGL01357:Orc2 APN 1 58497393 missense probably benign 0.00
IGL02167:Orc2 APN 1 58483639 unclassified probably benign
IGL02343:Orc2 APN 1 58469666 critical splice donor site probably null
IGL02548:Orc2 APN 1 58466122 unclassified probably benign
R0557:Orc2 UTSW 1 58469687 missense probably damaging 1.00
R1470:Orc2 UTSW 1 58481158 unclassified probably benign
R1886:Orc2 UTSW 1 58471088 critical splice acceptor site probably null
R2065:Orc2 UTSW 1 58469695 missense probably damaging 1.00
R3848:Orc2 UTSW 1 58480992 missense probably benign 0.08
R4389:Orc2 UTSW 1 58474861 missense probably benign 0.21
R4393:Orc2 UTSW 1 58467650 critical splice donor site probably null
R4613:Orc2 UTSW 1 58500309 nonsense probably null
R5183:Orc2 UTSW 1 58474818 missense possibly damaging 0.83
R5652:Orc2 UTSW 1 58466072 missense probably damaging 0.99
R5793:Orc2 UTSW 1 58497388 start codon destroyed probably null 0.27
R5997:Orc2 UTSW 1 58472388 missense probably damaging 1.00
R6007:Orc2 UTSW 1 58467692 missense probably benign 0.03
R6330:Orc2 UTSW 1 58500334 missense probably benign
R6656:Orc2 UTSW 1 58493659 critical splice donor site probably null
R6923:Orc2 UTSW 1 58500375 missense probably benign 0.01
R6934:Orc2 UTSW 1 58500364 missense probably benign 0.28
R7354:Orc2 UTSW 1 58469747 missense possibly damaging 0.96
Z1088:Orc2 UTSW 1 58476516 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAACATTTAATGAGCACAGCGC -3'
(R):5'- TCCTGTCAGTAACGTTTTGTAGTCAG -3'

Sequencing Primer
(F):5'- CACAGCGCATTAACGTGTG -3'
(R):5'- CAGACATGTTGATACACTGTTGTTCC -3'
Posted On2019-11-12