Incidental Mutation 'R7718:Igfn1'
ID595009
Institutional Source Beutler Lab
Gene Symbol Igfn1
Ensembl Gene ENSMUSG00000051985
Gene Nameimmunoglobulin-like and fibronectin type III domain containing 1
Synonyms9830123M21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location135953578-136006342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135969036 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1264 (E1264G)
Ref Sequence ENSEMBL: ENSMUSP00000129680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166193]
Predicted Effect probably benign
Transcript: ENSMUST00000124134
SMART Domains Protein: ENSMUSP00000119230
Gene: ENSMUSG00000051985

DomainStartEndE-ValueType
IG 73 159 1.29e-6 SMART
IG_like 258 344 5.45e1 SMART
IG 354 435 1.79e0 SMART
IG 445 524 3.54e-4 SMART
IG 538 624 4.86e-2 SMART
FN3 627 711 3.99e-10 SMART
FN3 727 810 9.1e-14 SMART
FN3 828 911 1.5e-14 SMART
IG 938 1021 6.41e-2 SMART
FN3 1024 1106 3.2e-9 SMART
IGc2 1152 1219 4.89e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166193
AA Change: E1264G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129680
Gene: ENSMUSG00000051985
AA Change: E1264G

DomainStartEndE-ValueType
low complexity region 90 101 N/A INTRINSIC
IG 193 279 1.29e-6 SMART
PDB:2LHU|A 302 365 8e-7 PDB
IG_like 378 464 5.45e1 SMART
IG 474 555 1.79e0 SMART
low complexity region 724 739 N/A INTRINSIC
internal_repeat_2 838 1006 9.98e-5 PROSPERO
low complexity region 1067 1084 N/A INTRINSIC
internal_repeat_2 1812 1967 9.98e-5 PROSPERO
Pfam:I-set 2054 2139 6.2e-8 PFAM
IG 2153 2239 4.86e-2 SMART
FN3 2242 2326 3.99e-10 SMART
FN3 2342 2425 9.1e-14 SMART
FN3 2443 2526 1.5e-14 SMART
IG 2553 2636 6.41e-2 SMART
FN3 2639 2721 3.2e-9 SMART
IGc2 2767 2834 4.89e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Igfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Igfn1 APN 1 135966726 missense probably damaging 1.00
IGL02299:Igfn1 APN 1 135954017 utr 3 prime probably benign
Bounty UTSW 1 135976917 critical splice donor site probably null
R0144:Igfn1 UTSW 1 135962013 missense probably damaging 0.99
R0190:Igfn1 UTSW 1 135962052 missense probably damaging 1.00
R0350:Igfn1 UTSW 1 135956767 nonsense probably null
R0413:Igfn1 UTSW 1 135967596 missense probably benign 0.23
R0504:Igfn1 UTSW 1 135968529 missense probably benign 0.00
R0606:Igfn1 UTSW 1 135959901 missense probably damaging 1.00
R0681:Igfn1 UTSW 1 135963853 missense possibly damaging 0.88
R0825:Igfn1 UTSW 1 135963126 missense probably damaging 1.00
R0839:Igfn1 UTSW 1 135954680 missense probably damaging 1.00
R1066:Igfn1 UTSW 1 135970725 missense probably benign
R1078:Igfn1 UTSW 1 135974847 missense probably damaging 1.00
R1224:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R1569:Igfn1 UTSW 1 135969033 missense probably benign
R1626:Igfn1 UTSW 1 135968967 missense probably benign 0.29
R1663:Igfn1 UTSW 1 135968308 missense probably benign 0.15
R1677:Igfn1 UTSW 1 135971101 missense probably damaging 0.99
R1709:Igfn1 UTSW 1 135955573 missense probably benign 0.24
R1728:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1728:Igfn1 UTSW 1 135968199 missense probably benign
R1728:Igfn1 UTSW 1 135970411 missense probably benign
R1728:Igfn1 UTSW 1 135972127 missense probably benign
R1728:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1728:Igfn1 UTSW 1 135982475 missense probably benign
R1728:Igfn1 UTSW 1 135998625 missense probably benign
R1728:Igfn1 UTSW 1 135998683 missense unknown
R1729:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1729:Igfn1 UTSW 1 135968199 missense probably benign
R1729:Igfn1 UTSW 1 135970411 missense probably benign
R1729:Igfn1 UTSW 1 135972127 missense probably benign
R1729:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1729:Igfn1 UTSW 1 135982475 missense probably benign
R1729:Igfn1 UTSW 1 135998625 missense probably benign
R1729:Igfn1 UTSW 1 135998683 missense unknown
R1730:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1730:Igfn1 UTSW 1 135968199 missense probably benign
R1730:Igfn1 UTSW 1 135970411 missense probably benign
R1730:Igfn1 UTSW 1 135972127 missense probably benign
R1730:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1730:Igfn1 UTSW 1 135982475 missense probably benign
R1730:Igfn1 UTSW 1 135998625 missense probably benign
R1730:Igfn1 UTSW 1 135998683 missense unknown
R1739:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1739:Igfn1 UTSW 1 135968199 missense probably benign
R1739:Igfn1 UTSW 1 135970411 missense probably benign
R1739:Igfn1 UTSW 1 135972127 missense probably benign
R1739:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1739:Igfn1 UTSW 1 135982475 missense probably benign
R1739:Igfn1 UTSW 1 135998625 missense probably benign
R1739:Igfn1 UTSW 1 135998683 missense unknown
R1746:Igfn1 UTSW 1 135969823 missense possibly damaging 0.88
R1762:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1762:Igfn1 UTSW 1 135968199 missense probably benign
R1762:Igfn1 UTSW 1 135970411 missense probably benign
R1762:Igfn1 UTSW 1 135972127 missense probably benign
R1762:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1762:Igfn1 UTSW 1 135982475 missense probably benign
R1762:Igfn1 UTSW 1 135998625 missense probably benign
R1762:Igfn1 UTSW 1 135998683 missense unknown
R1783:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1783:Igfn1 UTSW 1 135968199 missense probably benign
R1783:Igfn1 UTSW 1 135970411 missense probably benign
R1783:Igfn1 UTSW 1 135972127 missense probably benign
R1783:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1783:Igfn1 UTSW 1 135982475 missense probably benign
R1783:Igfn1 UTSW 1 135998625 missense probably benign
R1783:Igfn1 UTSW 1 135998683 missense unknown
R1784:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1784:Igfn1 UTSW 1 135968199 missense probably benign
R1784:Igfn1 UTSW 1 135970411 missense probably benign
R1784:Igfn1 UTSW 1 135972127 missense probably benign
R1784:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1784:Igfn1 UTSW 1 135982475 missense probably benign
R1784:Igfn1 UTSW 1 135998625 missense probably benign
R1784:Igfn1 UTSW 1 135998683 missense unknown
R1785:Igfn1 UTSW 1 135959928 missense probably damaging 1.00
R1785:Igfn1 UTSW 1 135968199 missense probably benign
R1785:Igfn1 UTSW 1 135970411 missense probably benign
R1785:Igfn1 UTSW 1 135972127 missense probably benign
R1785:Igfn1 UTSW 1 135979915 missense probably benign 0.00
R1785:Igfn1 UTSW 1 135982475 missense probably benign
R1785:Igfn1 UTSW 1 135998625 missense probably benign
R1785:Igfn1 UTSW 1 135998683 missense unknown
R1847:Igfn1 UTSW 1 135969388 missense probably benign
R1866:Igfn1 UTSW 1 135974868 intron probably null
R1921:Igfn1 UTSW 1 135966063 critical splice donor site probably null
R1984:Igfn1 UTSW 1 135962044 missense probably benign 0.39
R2049:Igfn1 UTSW 1 135970638 missense probably benign
R2049:Igfn1 UTSW 1 135974852 splice site probably benign
R2098:Igfn1 UTSW 1 135978305 missense probably damaging 1.00
R2130:Igfn1 UTSW 1 135974852 splice site probably benign
R2141:Igfn1 UTSW 1 135974852 splice site probably benign
R2276:Igfn1 UTSW 1 135964741 missense probably damaging 0.98
R2425:Igfn1 UTSW 1 135963102 missense probably damaging 1.00
R2483:Igfn1 UTSW 1 135969537 missense probably benign
R2504:Igfn1 UTSW 1 135969316 missense probably benign 0.07
R3109:Igfn1 UTSW 1 135997848 missense probably benign 0.12
R3421:Igfn1 UTSW 1 135976917 critical splice donor site probably null
R3423:Igfn1 UTSW 1 135998641 missense probably benign 0.01
R3705:Igfn1 UTSW 1 135968409 missense probably benign
R3871:Igfn1 UTSW 1 135968836 missense probably benign 0.03
R3875:Igfn1 UTSW 1 135954614 missense probably damaging 1.00
R3953:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3955:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3957:Igfn1 UTSW 1 135967180 missense possibly damaging 0.61
R3965:Igfn1 UTSW 1 135967819 missense probably benign
R4006:Igfn1 UTSW 1 135982362 splice site probably null
R4058:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4059:Igfn1 UTSW 1 135969756 missense probably benign 0.07
R4370:Igfn1 UTSW 1 135968106 missense probably benign 0.00
R4380:Igfn1 UTSW 1 135967771 missense probably benign 0.00
R4495:Igfn1 UTSW 1 135969678 missense possibly damaging 0.79
R4628:Igfn1 UTSW 1 135959730 missense possibly damaging 0.47
R4672:Igfn1 UTSW 1 135965369 missense possibly damaging 0.72
R4682:Igfn1 UTSW 1 135998625 missense probably benign
R4702:Igfn1 UTSW 1 135967209 missense possibly damaging 0.71
R4744:Igfn1 UTSW 1 135982458 missense probably benign 0.07
R4777:Igfn1 UTSW 1 135954862 missense probably benign
R4806:Igfn1 UTSW 1 135967357 missense probably benign 0.01
R4840:Igfn1 UTSW 1 135968040 missense probably benign 0.00
R4894:Igfn1 UTSW 1 135954782 missense probably damaging 1.00
R4998:Igfn1 UTSW 1 135954666 missense probably damaging 1.00
R5092:Igfn1 UTSW 1 135964826 missense probably benign
R5108:Igfn1 UTSW 1 135982441 missense probably benign
R5120:Igfn1 UTSW 1 135973502 missense possibly damaging 0.93
R5127:Igfn1 UTSW 1 135959896 missense probably damaging 1.00
R5231:Igfn1 UTSW 1 135966736 missense probably benign 0.26
R5286:Igfn1 UTSW 1 135967861 missense probably benign 0.10
R5307:Igfn1 UTSW 1 135964938 missense probably damaging 1.00
R5380:Igfn1 UTSW 1 135966087 missense probably damaging 1.00
R5553:Igfn1 UTSW 1 135967884 missense probably damaging 1.00
R5660:Igfn1 UTSW 1 135970414 missense probably benign 0.01
R5779:Igfn1 UTSW 1 135966840 missense probably benign 0.16
R5818:Igfn1 UTSW 1 135966126 missense possibly damaging 0.72
R5832:Igfn1 UTSW 1 135974795 missense probably damaging 0.96
R5933:Igfn1 UTSW 1 135970603 nonsense probably null
R5966:Igfn1 UTSW 1 135965414 missense probably damaging 1.00
R6116:Igfn1 UTSW 1 135970467 missense probably benign 0.00
R6297:Igfn1 UTSW 1 135964661 critical splice donor site probably null
R6652:Igfn1 UTSW 1 135963871 missense probably damaging 1.00
R6737:Igfn1 UTSW 1 135969867 missense probably benign
R6816:Igfn1 UTSW 1 135959728 missense probably benign 0.02
R6886:Igfn1 UTSW 1 135973460 missense probably damaging 1.00
R6888:Igfn1 UTSW 1 135982480 missense probably benign 0.33
R6975:Igfn1 UTSW 1 135968445 missense probably damaging 0.96
R7105:Igfn1 UTSW 1 135984218 missense probably benign 0.11
R7114:Igfn1 UTSW 1 135966781 missense probably benign 0.01
R7233:Igfn1 UTSW 1 135970135 missense probably benign 0.41
R7276:Igfn1 UTSW 1 135998638 missense possibly damaging 0.85
R7354:Igfn1 UTSW 1 135976032 missense possibly damaging 0.72
R7358:Igfn1 UTSW 1 135964000 missense probably damaging 1.00
R7380:Igfn1 UTSW 1 135962008 missense probably damaging 1.00
R7389:Igfn1 UTSW 1 135967047 missense probably benign 0.00
R7513:Igfn1 UTSW 1 135959967 missense probably damaging 1.00
R7769:Igfn1 UTSW 1 135982405 missense possibly damaging 0.85
R7810:Igfn1 UTSW 1 135974789 missense probably damaging 0.98
R8041:Igfn1 UTSW 1 135968059 nonsense probably null
Z1176:Igfn1 UTSW 1 135972000 missense probably damaging 0.99
Z1177:Igfn1 UTSW 1 135955809 missense probably damaging 1.00
Z1177:Igfn1 UTSW 1 135969567 missense probably benign 0.26
Z1177:Igfn1 UTSW 1 135982426 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- GGCTTTGTCCCAATTCCCAG -3'
(R):5'- TCTAGTGAAGCTCAGCAGAGG -3'

Sequencing Primer
(F):5'- AGTTCCAACTGTAGAGGTCCTG -3'
(R):5'- TATTTCAAGGCCACGGTCAG -3'
Posted On2019-11-12