Incidental Mutation 'R7718:Strbp'
ID595013
Institutional Source Beutler Lab
Gene Symbol Strbp
Ensembl Gene ENSMUSG00000026915
Gene Namespermatid perinuclear RNA binding protein
Synonyms6430510M02Rik, Spnr, C230082I21Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.512) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location37483228-37703859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37625282 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 244 (E244G)
Ref Sequence ENSEMBL: ENSMUSP00000072047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028279] [ENSMUST00000072186] [ENSMUST00000183690]
Predicted Effect probably damaging
Transcript: ENSMUST00000028279
AA Change: E244G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028279
Gene: ENSMUSG00000026915
AA Change: E244G

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072186
AA Change: E244G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072047
Gene: ENSMUSG00000026915
AA Change: E244G

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183690
AA Change: E244G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139145
Gene: ENSMUSG00000026915
AA Change: E244G

DomainStartEndE-ValueType
DZF 81 334 2.45e-168 SMART
DSRM 388 452 3.11e-16 SMART
low complexity region 474 497 N/A INTRINSIC
DSRM 511 575 1.2e-22 SMART
low complexity region 578 593 N/A INTRINSIC
low complexity region 608 618 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap insertion exhibit premature death, a reduced body size and an abnormal clutching reflex. Minor brain abnormalities and spermatogenesis defects were also noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Adcy5 T C 16: 35,280,415 V779A probably benign Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Strbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Strbp APN 2 37586504 splice site probably benign
IGL00656:Strbp APN 2 37603138 splice site probably benign
IGL01376:Strbp APN 2 37645651 missense probably damaging 1.00
IGL01998:Strbp APN 2 37625285 missense probably damaging 1.00
IGL02347:Strbp APN 2 37645648 missense probably benign 0.25
IGL02453:Strbp APN 2 37586508 critical splice donor site probably null
IGL02804:Strbp APN 2 37624486 splice site probably benign
IGL03102:Strbp APN 2 37586503 splice site probably benign
PIT4418001:Strbp UTSW 2 37645492 missense probably benign
R0382:Strbp UTSW 2 37600826 missense probably benign 0.00
R0575:Strbp UTSW 2 37640873 missense possibly damaging 0.87
R0610:Strbp UTSW 2 37584077 missense probably damaging 0.97
R0825:Strbp UTSW 2 37635527 missense probably benign 0.00
R1829:Strbp UTSW 2 37640909 missense possibly damaging 0.63
R1831:Strbp UTSW 2 37625265 missense possibly damaging 0.71
R3416:Strbp UTSW 2 37590725 missense possibly damaging 0.94
R3417:Strbp UTSW 2 37590725 missense possibly damaging 0.94
R4673:Strbp UTSW 2 37645679 missense probably damaging 1.00
R5093:Strbp UTSW 2 37627487 missense probably damaging 0.99
R5099:Strbp UTSW 2 37603018 missense probably damaging 0.98
R5269:Strbp UTSW 2 37627443 missense possibly damaging 0.87
R5378:Strbp UTSW 2 37599174 missense probably damaging 1.00
R5378:Strbp UTSW 2 37600806 missense probably benign 0.03
R5454:Strbp UTSW 2 37645483 missense probably benign 0.00
R5905:Strbp UTSW 2 37625255 missense probably damaging 1.00
R6028:Strbp UTSW 2 37625255 missense probably damaging 1.00
R6374:Strbp UTSW 2 37603008 missense probably damaging 1.00
R6700:Strbp UTSW 2 37603963 missense probably null 0.01
R6800:Strbp UTSW 2 37625216 missense probably damaging 1.00
R7032:Strbp UTSW 2 37603113 missense possibly damaging 0.92
R7139:Strbp UTSW 2 37624502 missense probably benign 0.00
R7261:Strbp UTSW 2 37641137 intron probably null
R7481:Strbp UTSW 2 37600754 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGCAGAGGACAAACATTTAGC -3'
(R):5'- AGCTGTTAAAGTCTAGGTTCACAAC -3'

Sequencing Primer
(F):5'- CAGAGGACAAACATTTAGCATATGC -3'
(R):5'- GGGAAGAGTTAAATGCTCCTTA -3'
Posted On2019-11-12